Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

MIRacle™ rno-miR-3571 miRNA Agomir/Antagomir

MicroRNA: rno-miR-3571 Accession Number: MIMAT0017851 Mature Sequence UACACACUUCUUUACAUUCCAUA rno-miR-3571 are small non-coding RNAs of 20-22 nucleotides, typically excised from 60-110 nucleotide foldback RNA precursor structures. miRNAs are involved in crucial biological processes, including development, differentiation, apoptosis, and proliferation, through imperfect pairing with target messenger RNAs (mRNAs) of protein-coding genes and the transcriptional or post-transcriptional regulation of their expression. Click here to browse detailed information about rno-miR-3571 in miRBase. What is MicroRNA Agomir/Antagomir? MicroRNA Agomir is a special-labeled and chemically modified double-stranded small RNA that mimics the endogenous miRNA to regulate the biological function of the target gene. MicroRNA Antagomir is an especially chemically modified miRNA antagonist. It strongly competes with mature miRNAs in the body to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning. Why choose rno-miR-3571 miRNA Agomir/Antagomir from AcceGen? AcceGen has extended experience in MicroRNA Agomir/Antagomir synthesis services that cover all human, mouse, and rat miRNAs in the current miRBase. Compared to standard miRNA mimics and inhibitors, AcceGen miRNA agomir and antagomir are more resistant to degradation, thus having a lasting effect: minimum for 1 week, up to 5-6 weeks. These products can be used in in vitro or in vivo miRNA functional studies.

Product Specifications

Applications

For research use only

Storage Conditions

Room Temperature

More Discoveries

Explore Other Products

Browse additional items from our catalog

HPN Antibody
A25529-100UG 100 µg

HPN Antibody

Sign In for Pricing
View Details
Lentiviral mouse Nt5c1a shRNA (UAS) - Lentiviral mouse Nt5c1a shRNA (UAS, RFP) (100)
GTR15291216 1 Vial

Lentiviral mouse Nt5c1a shRNA (UAS) - Lentiviral mouse Nt5c1a shRNA (UAS, RFP) (100)

Sign In for Pricing
View Details
Slc12a2 (NM_009194) Mouse Tagged ORF Clone
MG227334 10 µg

Slc12a2 (NM_009194) Mouse Tagged ORF Clone

Sign In for Pricing
View Details
Ermp1 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)
K4184005 3x 1.0 µg

Ermp1 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)

Sign In for Pricing
View Details
pCMV-SPORT6-Cyp2c50 Plasmid
PVT44569 2 µg

pCMV-SPORT6-Cyp2c50 Plasmid

Sign In for Pricing
View Details
Iduronate 2-Sulfatase/IDS
MBS200476-01 0.05 mL

Iduronate 2-Sulfatase/IDS

Sign In for Pricing
View Details