Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

MIRacle™ hsa-miR-518e-3p miRNA Agomir/Antagomir

MicroRNA: hsa-miR-518e-3p Accession Number: MIMAT0002861 Mature Sequence: AAAGCGCUUCCCUUCAGAGUG hsa-miR-518e-3p are small non-coding RNAs of 20-22 nucleotides, typically excised from 60-110 nucleotide foldback RNA precursor structures. miRNAs are involved in crucial biological processes, including development, differentiation, apoptosis, and proliferation, through imperfect pairing with target messenger RNAs (mRNAs) of protein-coding genes and the transcriptional or post-transcriptional regulation of their expression. Click here to browse detailed information about hsa-miR-518e-3p in miRBase. What is MicroRNA Agomir/Antagomir? MicroRNA Agomir is a special-labeled and chemically modified double-stranded small RNA that mimics the endogenous miRNA to regulate the biological function of the target gene. MicroRNA Antagomir is an especially chemically modified miRNA antagonist. It strongly competes with mature miRNAs in the body to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning. Why choose hsa-miR-518e-3p miRNA Agomir/Antagomir from AcceGen? AcceGen has extended experience in MicroRNA Agomir/Antagomir synthesis services that cover all human, mouse, and rat miRNAs in the current miRBase. Compared to standard miRNA mimics and inhibitors, AcceGen miRNA agomir and antagomir are more resistant to degradation, thus having a lasting effect: minimum for 1 week, up to 5-6 weeks. These products can be used in in vitro or in vivo miRNA functional studies.

Product Specifications

Applications

For research use only

Storage Conditions

Room Temperature

More Discoveries

Explore Other Products

Browse additional items from our catalog

Recombinant Human RHOBTB3, His-tagged
RHOBTB3-2292H 25 µg

Recombinant Human RHOBTB3, His-tagged

Sign In for Pricing
View Details
RAB3A CRISPR All-in-one AAV vector set (with saCas9)(Mouse)
38333154 3x 1.0 µg DNA

RAB3A CRISPR All-in-one AAV vector set (with saCas9)(Mouse)

Sign In for Pricing
View Details
SFTPB, ID (SFTPB, SFTP3, Pulmonary surfactant-associated protein B, 18kD pulmonary-surfactant protein, 6kD protein, Pulmonary surfactant-associated proteolipid SPL(Phe)) (Azide free) (HRP)
MBS6346761-01 0.2 mL

SFTPB, ID (SFTPB, SFTP3, Pulmonary surfactant-associated protein B, 18kD pulmonary-surfactant protein, 6kD protein, Pulmonary surfactant-associated proteolipid SPL(Phe)) (Azide free) (HRP)

Sign In for Pricing
View Details
SFTPB, ID (SFTPB, SFTP3, Pulmonary surfactant-associated protein B, 18kD pulmonary-surfactant protein, 6kD protein, Pulmonary surfactant-associated proteolipid SPL(Phe)) (Azide free) (HRP)
MBS6346761-02 5x 0.2 mL

SFTPB, ID (SFTPB, SFTP3, Pulmonary surfactant-associated protein B, 18kD pulmonary-surfactant protein, 6kD protein, Pulmonary surfactant-associated proteolipid SPL(Phe)) (Azide free) (HRP)

Sign In for Pricing
View Details
Tpd52l2 (NM_198744) Rat Tagged ORF Clone
RR209262 10 µg

Tpd52l2 (NM_198744) Rat Tagged ORF Clone

Sign In for Pricing
View Details
BOLA1 Protein, Human, Recombinant (His)
MF-0135080-01 5 µg

BOLA1 Protein, Human, Recombinant (His)

Sign In for Pricing
View Details