Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

MIRacle™ hsa-miR-3923 miRNA Agomir/Antagomir

MicroRNA: hsa-miR-3923 Accession Number: MIMAT0018198 Mature Sequence: AACUAGUAAUGUUGGAUUAGGG hsa-miR-3923 are small non-coding RNAs of 20-22 nucleotides, typically excised from 60-110 nucleotide foldback RNA precursor structures. miRNAs are involved in crucial biological processes, including development, differentiation, apoptosis, and proliferation, through imperfect pairing with target messenger RNAs (mRNAs) of protein-coding genes and the transcriptional or post-transcriptional regulation of their expression. Click here to browse detailed information about hsa-miR-3923 in miRBase. What is MicroRNA Agomir/Antagomir? MicroRNA Agomir is a special-labeled and chemically modified double-stranded small RNA that mimics the endogenous miRNA to regulate the biological function of the target gene. MicroRNA Antagomir is an especially chemically modified miRNA antagonist. It strongly competes with mature miRNAs in the body to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning. Why choose hsa-miR-3923 miRNA Agomir/Antagomir from AcceGen? AcceGen has extended experience in MicroRNA Agomir/Antagomir synthesis services that cover all human, mouse, and rat miRNAs in the current miRBase. Compared to standard miRNA mimics and inhibitors, AcceGen miRNA agomir and antagomir are more resistant to degradation, thus having a lasting effect: minimum for 1 week, up to 5-6 weeks. These products can be used in in vitro or in vivo miRNA functional studies.

Product Specifications

Applications

For research use only

Storage Conditions

Room Temperature

Frequently Asked Questions

More Discoveries

Explore Other Products

Browse additional items from our catalog

Srprb ORF Vector (Mouse) (pORF)
ORF058488 1.0 µg DNA

Srprb ORF Vector (Mouse) (pORF)

Sign In for Pricing
View Details
TECK (CCL25)
100-102-L250 250 µg

TECK (CCL25)

Sign In for Pricing
View Details
ANKTM1 CRISPR/Cas9 KO Plasmid (m)
sc-435491 20 µg

ANKTM1 CRISPR/Cas9 KO Plasmid (m)

Sign In for Pricing
View Details
Polyclonal Rabbit Gastrin Antibody
orb302980 250 µL

Polyclonal Rabbit Gastrin Antibody

Sign In for Pricing
View Details
Chicken Breakpoint cluster region protein (BCR) ELISA Kit
GTR10356928 96 Well

Chicken Breakpoint cluster region protein (BCR) ELISA Kit

Sign In for Pricing
View Details
Alexa Fluor® 750-conjugated Goat Anti-Rabbit IgG H&L
HY-P89174 1 Each

Alexa Fluor® 750-conjugated Goat Anti-Rabbit IgG H&L

Sign In for Pricing
View Details