Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

MIRacle™ hsa-miR-1-5p miRNA Agomir/Antagomir

MicroRNA: hsa-miR-1-5p Accession Number: MIMAT0031892 Mature Sequence: ACAUACUUCUUUAUAUGCCCAU hsa-miR-1-5p are small non-coding RNAs of 20-22 nucleotides, typically excised from 60-110 nucleotide foldback RNA precursor structures. miRNAs are involved in crucial biological processes, including development, differentiation, apoptosis, and proliferation, through imperfect pairing with target messenger RNAs (mRNAs) of protein-coding genes and the transcriptional or post-transcriptional regulation of their expression. Click here to browse detailed information about hsa-miR-1-5p in miRBase. What is MicroRNA Agomir/Antagomir? MicroRNA Agomir is a special-labeled and chemically modified double-stranded small RNA that mimics the endogenous miRNA to regulate the biological function of the target gene. MicroRNA Antagomir is an especially chemically modified miRNA antagonist. It strongly competes with mature miRNAs in the body to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning. Why choose hsa-miR-1-5p miRNA Agomir/Antagomir from AcceGen? AcceGen has extended experience in MicroRNA Agomir/Antagomir synthesis services that cover all human, mouse, and rat miRNAs in the current miRBase. Compared to standard miRNA mimics and inhibitors, AcceGen miRNA agomir and antagomir are more resistant to degradation, thus having a lasting effect: minimum for 1 week, up to 5-6 weeks. These products can be used in in vitro or in vivo miRNA functional studies.

Product Specifications

Applications

For research use only

Storage Conditions

Room Temperature

More Discoveries

Explore Other Products

Browse additional items from our catalog

VSIG2 Antibody, Biotin conjugated
A63232-100UG 100 µg

VSIG2 Antibody, Biotin conjugated

Sign In for Pricing
View Details
PGAP-ATP9-roGFP1-URA3 Plasmid
PVT63620 2 µg

PGAP-ATP9-roGFP1-URA3 Plasmid

Sign In for Pricing
View Details
Human UCHL3 knockdown cell line
ABC-KD16484 1 Vial

Human UCHL3 knockdown cell line

Sign In for Pricing
View Details
Rabbit Monoclonal TYRP1 Antibody (TYRP1/2340R) [Alexa Fluor 405]
NBP3-08898AF405 100 µL

Rabbit Monoclonal TYRP1 Antibody (TYRP1/2340R) [Alexa Fluor 405]

Sign In for Pricing
View Details
SPBP Double Nickase Plasmid (h)
sc-405638-NIC 20 µg

SPBP Double Nickase Plasmid (h)

Sign In for Pricing
View Details
Thyroglobulin (TG) Mouse Monoclonal Antibody [Clone ID: OTI8F6]
TA804215 100 µL

Thyroglobulin (TG) Mouse Monoclonal Antibody [Clone ID: OTI8F6]

Sign In for Pricing
View Details