Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

MIRacle™ hsa-miR-4437 miRNA Agomir/Antagomir

MicroRNA: hsa-miR-4437 Accession Number: MIMAT0018953 Mature Sequence: UGGGCUCAGGGUACAAAGGUU hsa-miR-4437 are small non-coding RNAs of 20-22 nucleotides, typically excised from 60-110 nucleotide foldback RNA precursor structures. miRNAs are involved in crucial biological processes, including development, differentiation, apoptosis, and proliferation, through imperfect pairing with target messenger RNAs (mRNAs) of protein-coding genes and the transcriptional or post-transcriptional regulation of their expression. Click here to browse detailed information about hsa-miR-4437 in miRBase. What is MicroRNA Agomir/Antagomir? MicroRNA Agomir is a special-labeled and chemically modified double-stranded small RNA that mimics the endogenous miRNA to regulate the biological function of the target gene. MicroRNA Antagomir is an especially chemically modified miRNA antagonist. It strongly competes with mature miRNAs in the body to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning. Why choose hsa-miR-4437 miRNA Agomir/Antagomir from AcceGen? AcceGen has extended experience in MicroRNA Agomir/Antagomir synthesis services that cover all human, mouse, and rat miRNAs in the current miRBase. Compared to standard miRNA mimics and inhibitors, AcceGen miRNA agomir and antagomir are more resistant to degradation, thus having a lasting effect: minimum for 1 week, up to 5-6 weeks. These products can be used in in vitro or in vivo miRNA functional studies.

Product Specifications

Applications

For research use only

Storage Conditions

Room Temperature

Frequently Asked Questions

More Discoveries

Explore Other Products

Browse additional items from our catalog

Mouse Alpha 2,8 sialyltransferase 8F (ST8SIA6) ELISA kit
GTR10382584 96 Well

Mouse Alpha 2,8 sialyltransferase 8F (ST8SIA6) ELISA kit

Sign In for Pricing
View Details
PPP2R2A Human siRNA Oligo Duplex (Locus ID 5520)
SR303686 1 Kit

PPP2R2A Human siRNA Oligo Duplex (Locus ID 5520)

Sign In for Pricing
View Details
GFOGER peptide
HY-P11328 1 Each

GFOGER peptide

Sign In for Pricing
View Details
HMGN2 Protein Lysate (Rat) with C-HA Tag
23625036 100 µg

HMGN2 Protein Lysate (Rat) with C-HA Tag

Sign In for Pricing
View Details
KIT, phosphorylated (Y936) (KIT, SCFR, Mast/stem cell growth factor receptor Kit, Piebald trait protein, Proto-oncogene c-Kit, Tyrosine-protein kinase Kit, p145 c-kit, v-kit Hardy-Zuckerman 4 feline sarcoma viral oncogene homolog, CD117)
037513 200 µL

KIT, phosphorylated (Y936) (KIT, SCFR, Mast/stem cell growth factor receptor Kit, Piebald trait protein, Proto-oncogene c-Kit, Tyrosine-protein kinase Kit, p145 c-kit, v-kit Hardy-Zuckerman 4 feline sarcoma viral oncogene homolog, CD117)

Sign In for Pricing
View Details
CCDC8 Protein Vector (Rat) (pPM-C-His)
PV258093 500 ng

CCDC8 Protein Vector (Rat) (pPM-C-His)

Sign In for Pricing
View Details