Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

MIRacle™ hsa-miR-6879-3p miRNA Agomir/Antagomir

MicroRNA: hsa-miR-6879-3p Accession Number: MIMAT0027659 Mature Sequence: UGUCACCCGCUCCUUGCCCAG hsa-miR-6879-3p are small non-coding RNAs of 20-22 nucleotides, typically excised from 60-110 nucleotide foldback RNA precursor structures. miRNAs are involved in crucial biological processes, including development, differentiation, apoptosis, and proliferation, through imperfect pairing with target messenger RNAs (mRNAs) of protein-coding genes and the transcriptional or post-transcriptional regulation of their expression. Click here to browse detailed information about hsa-miR-6879-3p in miRBase. What is MicroRNA Agomir/Antagomir? MicroRNA Agomir is a special-labeled and chemically modified double-stranded small RNA that mimics the endogenous miRNA to regulate the biological function of the target gene. MicroRNA Antagomir is an especially chemically modified miRNA antagonist. It strongly competes with mature miRNAs in the body to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning. Why choose hsa-miR-6879-3p miRNA Agomir/Antagomir from AcceGen? AcceGen has extended experience in MicroRNA Agomir/Antagomir synthesis services that cover all human, mouse, and rat miRNAs in the current miRBase. Compared to standard miRNA mimics and inhibitors, AcceGen miRNA agomir and antagomir are more resistant to degradation, thus having a lasting effect: minimum for 1 week, up to 5-6 weeks. These products can be used in in vitro or in vivo miRNA functional studies.

Product Specifications

Applications

For research use only

Storage Conditions

Room Temperature

More Discoveries

Explore Other Products

Browse additional items from our catalog

DPYSL5 Polyclonal Antibody
E55A03299 100 µg

DPYSL5 Polyclonal Antibody

Sign In for Pricing
View Details
Apigeninidin chloride
MBS5788677 Inquire

Apigeninidin chloride

Sign In for Pricing
View Details
ESR1 Monoclonal Antibody
A76629-50UL 50 μL

ESR1 Monoclonal Antibody

Sign In for Pricing
View Details
RNMTL1 Protein Vector (Mouse) (pPM-C-His)
PV224997 500 ng

RNMTL1 Protein Vector (Mouse) (pPM-C-His)

Sign In for Pricing
View Details
PKR (EIF2AK2) Mouse Monoclonal Antibody [Clone ID: OTI3F5]
CF813289 100 µg

PKR (EIF2AK2) Mouse Monoclonal Antibody [Clone ID: OTI3F5]

Sign In for Pricing
View Details
LRRC73 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV)
LV767099 1.0 µg DNA

LRRC73 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV)

Sign In for Pricing
View Details