Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

MIRacle™ hsa-miR-372-3p miRNA Agomir/Antagomir

MicroRNA: hsa-miR-372-3p Accession Number: MIMAT0000724 Mature Sequence: AAAGUGCUGCGACAUUUGAGCGU hsa-miR-372-3p are small non-coding RNAs of 20-22 nucleotides, typically excised from 60-110 nucleotide foldback RNA precursor structures. miRNAs are involved in crucial biological processes, including development, differentiation, apoptosis, and proliferation, through imperfect pairing with target messenger RNAs (mRNAs) of protein-coding genes and the transcriptional or post-transcriptional regulation of their expression. Click here to browse detailed information about hsa-miR-372-3p in miRBase. What is MicroRNA Agomir/Antagomir? MicroRNA Agomir is a special-labeled and chemically modified double-stranded small RNA that mimics the endogenous miRNA to regulate the biological function of the target gene. MicroRNA Antagomir is an especially chemically modified miRNA antagonist. It strongly competes with mature miRNAs in the body to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning. Why choose hsa-miR-372-3p miRNA Agomir/Antagomir from AcceGen? AcceGen has extended experience in MicroRNA Agomir/Antagomir synthesis services that cover all human, mouse, and rat miRNAs in the current miRBase. Compared to standard miRNA mimics and inhibitors, AcceGen miRNA agomir and antagomir are more resistant to degradation, thus having a lasting effect: minimum for 1 week, up to 5-6 weeks. These products can be used in in vitro or in vivo miRNA functional studies.

Product Specifications

Applications

For research use only

Storage Conditions

Room Temperature

More Discoveries

Explore Other Products

Browse additional items from our catalog

ITGA8 Antibody, FITC conjugated
A26540-50UL 50 μL

ITGA8 Antibody, FITC conjugated

Sign In for Pricing
View Details
VMAC Protein Vector (Mouse) (pPB-C-His)
PV245134 500 ng

VMAC Protein Vector (Mouse) (pPB-C-His)

Sign In for Pricing
View Details
Recombinant Mouse EGF Protein, C-Fc
E55P6221 50 µg

Recombinant Mouse EGF Protein, C-Fc

Sign In for Pricing
View Details
LEF1 (Lymphoid Enhancer-Binding Factor 1, DKFZp586H0919, TCF1ALPHA) (Biotin)
248117-Biotin 100 µL

LEF1 (Lymphoid Enhancer-Binding Factor 1, DKFZp586H0919, TCF1ALPHA) (Biotin)

Sign In for Pricing
View Details
Smoc2 Mouse Gene Knockout Kit (CRISPR)
KN516338 1 Kit

Smoc2 Mouse Gene Knockout Kit (CRISPR)

Sign In for Pricing
View Details
HEXIM2 (NM_144608) Human Recombinant Protein
TP304552L 1 mg

HEXIM2 (NM_144608) Human Recombinant Protein

Sign In for Pricing
View Details