Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

CD107a/LAMP1 Recombinant Protein

Product Specifications

Background

Lysosome-associated membrane protein 1 and 2 (LAMP1 and LAMP2) are two abundant lysosomal membrane proteins. Both are transmembrane proteins and are heavily glycosylated at the amino-terminal luminal side of the lysosomal inner leaflet, which protects the proteins from proteolysis. The carboxy terminus of LAMP1 is exposed to the cytoplasm and contains a tyrosine sorting motif that targets LAMP to lysosomal membranes. LAMP1 and LAMP2 are 37% homologous in their protein sequences. Both LAMP1 and LAMP2 are involved in regulating lysosomal motility during lysosome-phagosome fusion and cholesterol trafficking.

CAS Number

9000-83-3

Swiss Prot

P11279

Modification Site

NdeI-XhoI

Expression System

Pet-22b (+)

Tag

His-tag

Purity

Transferred into competent cells and the supernatant was purified by NI column affinity chromatography and the purity is > 85% (by SDS-PAGE) .

Solubility

PBS, 4M Urea, PH7.4

Molecular Weight

~37kDa

Storage Conditions

Store at 4°C short term. Aliquot and store at -20°C long term. Avoid freeze-thaw cycles.

Notes

For research use only, not for use in diagnostic procedure.

Host or Source

E.coli

AA Sequence

GCAATGTTCATGGTGAAAAATGGCAATGGTACCGCATGCATTATGGCCAACTTCAGTGCCGCATTCAGTGTTAATTATGATACCAAAAGCGGTCCGAAAAATATGACCTTCGATCTGCCGAGCGATGCAACCGTGGTTCTGAATCGCAGCAGTTGTGGCAAAGAAAATACCAGCGATCCGAGCCTGGTGATTGCATTCGGTCGTGGTCATACCCTGACCCTGAACTTCACCCGTAATGCCACCCGTTATAGTGTGCAGCTGATGAGCTTCGTGTATAATCTGAGTGATACCCATCTGTTCCCGAATGCAAGTAGCAAAGAAATTAAAACCGTTGAAAGTATCACCGATATTCGTGCAGATATTGATAAAAAATACCGCTGCGTGAGTGGTACCCAGGTGCACATGAATAATGTGACCGTTACCCTGCATGATGCCACCATTCAGGCATATCTGAGTAATAGTAGCTTCAGCCGCGGCGAAACCAGATGTGAACAGGATCGCCCGAGTCCGACCACCGCACCGCCTGCACCTCCGTCACCGAGTCCGAGCCCGGTTCCGAAAAGCCCGAGTGTGGATAAATATAATGTTAGCGGTACCAATGGTACCTGCCTGCTGGCAAGTATGGGCCTGCAGCTGAATCTGACCTATGAACGTAAAGATAATACCACCGTGACCCGTCTGCTGAATATTAATCCGAATAAAACCAGCGCCAGCGGTAGCTGTGGTGCACATCTGGTGACCCTGGAACTGCATAGTGAAGGTACCACCGTGCTGCTGTTCCAGTTCGGTATGAATGCAAGTAGTAGCCGCTTCTTCCTGCAGGGTATTCAGCTGAATACCATTCTGCCGGATGCACGCGATCCGGCCTTCAAAGCAGCCAATGGCAGCCTGCGCGCACTGCAGGCAACCGTTGGCAATAGCTATAAATGCAATGCCGAAGAACATGTGCGCGTTACCAAAGCATTCAGCGTTAATATCTTCAAAGTGTGGGTTCAGGCATTCAAAGTTGAAGGCGGTCAGTTCGGTAGTGTTGAAGAATGCCTGCTGGATGAAAATAGCATG

Available Sizes

Frequently Asked Questions

More Discoveries

Explore Other Products

Browse additional items from our catalog

Recombinant DTYMK Antibody
RC-5690-01 50 μL

Recombinant DTYMK Antibody

Sign In for Pricing
View Details
Recombinant DTYMK Antibody
RC-5690-02 100 µL

Recombinant DTYMK Antibody

Sign In for Pricing
View Details
Recombinant DTYMK Antibody
RC-5690-03 1 mL

Recombinant DTYMK Antibody

Sign In for Pricing
View Details
Polypyrrole (undoped, extent of labeling: ~20 wt. % loading, composite with carbon black)
TRC-P698945-250MG 250 mg

Polypyrrole (undoped, extent of labeling: ~20 wt. % loading, composite with carbon black)

Sign In for Pricing
View Details
Recombinant Rat MMP-12 protein (His tag)
PDER100181-01 20 µg

Recombinant Rat MMP-12 protein (His tag)

Sign In for Pricing
View Details
Recombinant Rat MMP-12 protein (His tag)
PDER100181-02 100 µg

Recombinant Rat MMP-12 protein (His tag)

Sign In for Pricing
View Details