CD69 Recombinant Protein
Product Specifications
Background
CD69, also known as Leu-23, is a type II transmembrane glycoprotein that is expressed on the surface of T cells, B cells, and NK cells. This phosphorylated disulfide-linked 28 to 32-kDa homodimer is constitutively expressed on a subset of thymocytes and platelets. It also acts as an activation antigen of lymphocytes, NK cells, neutrophils, and eosinophils. Studies have shown that stimulation of the T cell receptor (TCR) increases the expression of CD69 on the cell surface. The ability to detect the level of CD69 expression after TCR activation makes CD69 an ideal indicator of T cell activation. The FN50 antibody is widely used as a marker for T cell activation.
Swiss Prot
Q07108
Modification Site
NdeI-XhoI
Expression System
Pet-22b (+)
Tag
His-tag
Purity
Transferred into competent cells and the supernatant was purified by NI column affinity chromatography and the purity is > 85% (by SDS-PAGE) .
Solubility
PBS, 4M Urea, PH7.4
Molecular Weight
~17kDa
Storage Conditions
Store at 4°C short term. Aliquot and store at -20°C long term. Avoid freeze-thaw cycles.
Notes
For research use only, not for use in diagnostic procedure.
Host or Source
E.coli
CAS Number
9000-83-3
AA Sequence
AGCGTTGGTCAGTATAATTGTCCGGGTCAGTATACCTTCAGCATGCCGAGTGATAGCCATGTGAGTAGTTGTAGTGAAGATTGGGTGGGTTATCAGCGCAAATGCTACTTCATTAGCACCGTGAAACGCAGCTGGACCAGTGCACAGAATGCCTGCAGTGAACATGGCGCCACCCTGGCAGTGATTGATAGCGAAAAAGATATGAACTTCCTGAAACGTTATGCCGGTCGCGAAGAACATTGGGTTGGTCTGAAAAAAGAACCGGGTCATCCGTGGAAATGGAGTAATGGCAAAGAATTCAATAACTGGTTCAATGTTACCGGCAGTGATAAATGCGTGTTCCTGAAAAATACCGAAGTGAGTAGTATGGAATGTGAAAAAAATCTGTACTGGATCTGTAATAAGCCGTATAAA
Available Sizes
Curated Selection
Explore Other Products
Discover premium biology products from our extensive collection of 20M+ items
MBS6246778-01 0.1 mL
CD62L (L-selectin, CD62 Antigen-like Family Member L, Leukocyte Adhesion Molecule 1, LAM-1, Leukocyte Surface Antigen Leu-8, Leukocyte-endothelial Cell Adhesion Molecule 1, LECAM1, Lymph Node Homing Receptor, TQ1, gp90-MEL, CD62L, SELL, LNHR, LYAM1) (MaxL
Ask
View Details 
MBS6246778-02 5x 0.1 mL
CD62L (L-selectin, CD62 Antigen-like Family Member L, Leukocyte Adhesion Molecule 1, LAM-1, Leukocyte Surface Antigen Leu-8, Leukocyte-endothelial Cell Adhesion Molecule 1, LECAM1, Lymph Node Homing Receptor, TQ1, gp90-MEL, CD62L, SELL, LNHR, LYAM1) (MaxL
Ask
View Details 