Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

COMMD7 cDNA

COMMD7 (COMM Domain Containing 7) contains 1 COMM domain. It interacts (via COMM domain) with COMMD1 via its COMM domain and also associates with the NF-kappa-B complex and suppresses its transcriptional activity. COMMD7 is widely expressed with highest expression in lung

Product Specifications

Product Name Alternative

C20orf92, dJ1085F17.3

Chromosomal Location

20q11.21

Antigen Species

Human

Vector Type

PATGen (puc19-derived cloning vector)

Sequence

ATGGGCCGCCTGCACTGCACTGAGGACCCGGTGCCGGAGGCCGTGGGCGGCGACATGCAGCAGCTGAACCAGCTGGGCGCGCAGCAGTTCTCAGCCCTGACAGAGGTGCTTTTCCACTTCCTAACTGAGCCAAAAGAGGTGGAAAGATTTCTGGCTCAGCTCTCTGAATTTGCCACCACCAATCAGATCAGTCTTGGCTCCCTCAGAAGCATCGTGAAAAGCCTCCTTCTGGTTCCAAATGGTGCTTTGAAGAAGAGTCTCACAGCCAAGCAGGTCCAGGCGGATTTCATAACTCTGGGTCTTAGTGAGGAGAAAGCCACTTACTTTTCTGAAAAGTGGAAGCAGAATGCTCCCACCCTTGCTCGATGGGCCATAGGTCAGACTCTGATGATTAACCAGCTCATAGATATGGAGTGGAAATTTGGAGTGACATCTGGGAGCAGCGAATTGGAGAAAGTGGGAAGTATATTTTTACAACTAAAGTTGGTGGTTAAGAAAGGAAATCAAACCGAAAATGTGTATATAGAATTAACCTTGCCTCAGTTCTACAGCTTCCTGCACGAGATGGAGCGAGTCAGAACCAGCATGGAGTGTTTCTGCTGA

Additionnal Information

COMMD7, C20orf92, dJ1085F17.3, COMMD7, ATGD0464-10 µg, ATGD0464-20 µg, ATGD0464-50 µg, ATGD0464-100 µg, ATGD0464-250 µg, ATGD0464-500 µg, ATGD0464-1 mg, ATGD0464-10, ATGD0464-20, ATGD0464-50, ATGD0464-100, ATGD0464-250, ATGD0464-500, ATGD0464-1

Storage Conditions

Store the plasmid at -20C.

Formulation

Lyophilized

Scientific Category

Signal Transduction

NCBI Accession Number

NP_444269.2

Species

Human

Preparation

1. Centrifuge at 7000rpm for 1 minute.; ;2. Carefully open the vial and add 100 µL of sterile water to dissolve the DNA.; ; Each tube contains approximately 10 µg of lyophilized plasmid.

RNA Reference

NM_053041.2

DNA Size

603bp

Vector Description

This shuttle vector contains the complete ORF. It is inseted BamH I to Xho I. The gene insert contains multiple cloning sites which can be used to easily cut and transfer the gene and recombination site into your expression vector.

Frequently Asked Questions

More Discoveries

Explore Other Products

Browse additional items from our catalog

PSB-1114 (triethylamine)
HY-110092A-01 1 mg

PSB-1114 (triethylamine)

Sign In for Pricing
View Details
PSB-1114 (triethylamine)
HY-110092A-02 5 mg

PSB-1114 (triethylamine)

Sign In for Pricing
View Details
Polr2a sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 3)
K4393408 1.0 µg DNA

Polr2a sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 3)

Sign In for Pricing
View Details
Rabbit Polyclonal CALHM1 Antibody [Alexa Fluor 594]
NBP1-77112AF594 0.1 mL

Rabbit Polyclonal CALHM1 Antibody [Alexa Fluor 594]

Sign In for Pricing
View Details
C12ORF74 Antibody - middle region : HRP (ARP69643_P050-HRP)
ARP69643_P050-HRP 100 µL

C12ORF74 Antibody - middle region : HRP (ARP69643_P050-HRP)

Sign In for Pricing
View Details
Armenian Hamster Anti-Mouse CD69 mAb (PE)
orb2710460 100 Tests

Armenian Hamster Anti-Mouse CD69 mAb (PE)

Sign In for Pricing
View Details