Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

RPL13 cDNA

RPL13 encodes a ribosomal protein that is a component of the 60S subunit. RPL13 belongs to the L13E family of ribosomal proteins. RPL13 is located in the cytoplasm. RPL13 is expressed at significantly higher levels in benign breast lesions than in breast carcinomas. Alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. As is typical for genes encoding ribosomal proteins, there are multiple processed pseudogenes of RPL13 dispersed through the genome.

Product Specifications

Product Name Alternative

BBC1, D16S444E, D16S44E, L13

Chromosomal Location

16q24.3

Antigen Species

Human

Vector Type

PATGen (puc19-derived cloning vector)

Sequence

ATGGCGCCCAGCCGGAATGGCATGGTCTTGAAGCCCCACTTCCACAAGGACTGGCAGCGGCGCGTGGCCACGTGGTTCAACCAGCCGGCCCGTAAGATCCGCAGACGTAAGGCCCGGCAAGCCAAGGCGCGCCGCATCGCCCCGCGCCCCGCGTCGGGTCCCATCCGGCCCATCGTGCGCTGCCCCACGGTTCGGTACCACACGAAGGTGCGCGCCGGCCGCGGCTTCAGCCTGGAGGAGCTCAGGGTGGCCGGCATTCACAAGAAGGTGGCCCGGACCATCGGCATTTCTGTGGATCCGAGGAGGCGGAACAAGTCCACGGAGTCCCTGCAGGCCAACGTGCAGCGGCTGAAGGAGTACCGCTCCAAACTCATCCTCTTCCCCAGGAAGCCCTCGGCCCCCAAGAAGGGAGACAGTTCTGCTGAAGAACTGAAACTGGCCACCCAGCTGACCGGACCGGTCATGCCCGTCCGGAACGTCTATAAGAAGGAGAAAGCTCGAGTCATCACTGAGGAAGAGAAGAATTTCAAAGCCTTCGCTAGTCTCCGTATGGCCCGTGCCAACGCCCGGCTCTTCGGCATACGGGCAAAAAGAGCCAAGGAAGCCGCAGAACAGGATGTTGAAAAGAAAAAATAA

Additionnal Information

RPL13, BBC1, D16S444E, D16S44E, L13, RPL13, ATGD0324-10 µg, ATGD0324-20 µg, ATGD0324-50 µg, ATGD0324-100 µg, ATGD0324-250 µg, ATGD0324-500 µg, ATGD0324-1 mg, ATGD0324-10, ATGD0324-20, ATGD0324-50, ATGD0324-100, ATGD0324-250, ATGD0324-500, ATGD0324-1

Storage Conditions

Store the plasmid at -20C.

Formulation

Lyophilized

Scientific Category

Epigenetics and Nuclear Signaling

Omim

113703

NCBI Accession Number

NP_150254.1

Species

Human

Preparation

1. Centrifuge at 7000rpm for 1 minute.; ;2. Carefully open the vial and add 100 µL of sterile water to dissolve the DNA.; ; Each tube contains approximately 10 µg of lyophilized plasmid.

RNA Reference

NM_033251.2

DNA Size

636bp

Vector Description

This shuttle vector contains the complete ORF. It is inseted Nde I to Hind III. The gene insert contains multiple cloning sites which can be used to easily cut and transfer the gene and recombination site into your expression vector.
More Discoveries

Explore Other Products

Browse additional items from our catalog

DEFB4A ELISA Kit (Human)
OKEH00376-96W 96 Well

DEFB4A ELISA Kit (Human)

Sign In for Pricing
View Details
ZFYVE19, CT (ZFYVE19, MPFYVE, Zinc finger FYVE domain-containing protein 19, MLL partner containing FYVE domain) (Azide free) (HRP)
MBS6365275-01 0.2 mL

ZFYVE19, CT (ZFYVE19, MPFYVE, Zinc finger FYVE domain-containing protein 19, MLL partner containing FYVE domain) (Azide free) (HRP)

Sign In for Pricing
View Details
ZFYVE19, CT (ZFYVE19, MPFYVE, Zinc finger FYVE domain-containing protein 19, MLL partner containing FYVE domain) (Azide free) (HRP)
MBS6365275-02 5x 0.2 mL

ZFYVE19, CT (ZFYVE19, MPFYVE, Zinc finger FYVE domain-containing protein 19, MLL partner containing FYVE domain) (Azide free) (HRP)

Sign In for Pricing
View Details
Recombinant Corynebacterium glutamicum Diphtheria toxin repressor (dtxR)
MBS1432709-01 0.02 mg (E-Coli)

Recombinant Corynebacterium glutamicum Diphtheria toxin repressor (dtxR)

Sign In for Pricing
View Details
Recombinant Corynebacterium glutamicum Diphtheria toxin repressor (dtxR)
MBS1432709-02 0.1 mg (E-Coli)

Recombinant Corynebacterium glutamicum Diphtheria toxin repressor (dtxR)

Sign In for Pricing
View Details
Recombinant Corynebacterium glutamicum Diphtheria toxin repressor (dtxR)
MBS1432709-03 0.02 mg (Yeast)

Recombinant Corynebacterium glutamicum Diphtheria toxin repressor (dtxR)

Sign In for Pricing
View Details