Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

CD9 protein

Recombinant CD9 protein

Product Specifications

UniProt

P21926

Expression Region

Pet-22b (+)

Tag

His-tag

Field of Research

Immunology & Inflammation

Concentration

> 0.5mg/ml

Solubility

PBS, 4M Urea, PH7.4

Molecular Weight

~9kDa

Storage Conditions

Store at 4°C short term. Aliquot and store at -20°C long term. Avoid freeze-thaw cycles.

Notes

For research use only.

Applications Notes

NdeI-XhoI

Preservative

PBS, 4M Urea, pH 7.4

AA Sequence

AGTCATAAGGATGAAGTGATTAAGGAAGTGCAGGAATTCTATAAAGATACCTATAATAAGCTGAAGACCAAAGATGAACCGCAGCGTGAAACCTTAAAAGCAATTCATTATGCCCTGAATTGCTGTGGTCTGGCAGGTGGCGTGGAACAGTTCATTAGTGATATCTGTCCGAAAAAAGATGTTCTGGAAACCTTCACCGTTAAAAGCTGCCCGGATGCCATTAAAGAAGTGTTCGATAATAAATTCCACATC

Available Sizes

More Discoveries

Explore Other Products

Browse additional items from our catalog

TAF1A Polyclonal Antibody, Cy5.5 Conjugated
bs-12894R-Cy5.5 100 µL

TAF1A Polyclonal Antibody, Cy5.5 Conjugated

Sign In for Pricing
View Details
Rat Matrix metalloproteinase-24 (MMP24) ELISA Kit
orb1653994-01 48 Tests

Rat Matrix metalloproteinase-24 (MMP24) ELISA Kit

Sign In for Pricing
View Details
Rat Matrix metalloproteinase-24 (MMP24) ELISA Kit
orb1653994-02 96 Tests

Rat Matrix metalloproteinase-24 (MMP24) ELISA Kit

Sign In for Pricing
View Details
Recombinant Bacillus subtilis Energy-coupling factor transporter transmembrane protein EcfT (ecfT)
orb2911298-01 20 µg

Recombinant Bacillus subtilis Energy-coupling factor transporter transmembrane protein EcfT (ecfT)

Sign In for Pricing
View Details
Recombinant Bacillus subtilis Energy-coupling factor transporter transmembrane protein EcfT (ecfT)
orb2911298-02 100 µg

Recombinant Bacillus subtilis Energy-coupling factor transporter transmembrane protein EcfT (ecfT)

Sign In for Pricing
View Details
APOBEC3B Rabbit pAb
E45R28486N-50 50 µL

APOBEC3B Rabbit pAb

Sign In for Pricing
View Details