Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

CD79A protein

Recombinant CD79A protein

Product Specifications

UniProt

P11912

Expression Region

Pet-22b (+)

Tag

His-tag

Field of Research

Immunology & Inflammation

Concentration

> 0.5mg/ml

Solubility

PBS, 4M Urea, PH7.4

Molecular Weight

~15kDa

Storage Conditions

Store at 4°C short term. Aliquot and store at -20°C long term. Avoid freeze-thaw cycles.

Notes

For research use only.

Applications Notes

NdeI-XhoI

Preservative

PBS, 4M Urea, pH 7.4

AA Sequence

CTGTGGATGCATAAAGTGCCGGCCAGCCTGATGGTTAGCCTGGGCGAAGATGCACACTTCCAGTGTCCGCATAATAGTAGTAATAATGCAAATGTGACCTGGTGGCGCGTGCTGCATGGTAATTATACCTGGCCGCCGGAATTCCTGGGTCCGGGTGAAGATCCGAATGGTACCCTGATTATTCAGAATGTTAATAAAAGCCACGGCGGTATCTATGTGTGTCGTGTTCAGGAAGGCAATGAAAGTTATCAGCAGAGCTGTGGTACCTATCTGCGTGTTCGTCAGCCGCCGCCGCGCCCGTTCTTAGATATGGGTGAAGGTACCAAAAATCGT

Available Sizes

Frequently Asked Questions

More Discoveries

Explore Other Products

Browse additional items from our catalog

Human Reelin (RL) ELISA Kit
MBS451779-01 48 Tests

Human Reelin (RL) ELISA Kit

Sign In for Pricing
View Details
Human Reelin (RL) ELISA Kit
MBS451779-02 96 Tests

Human Reelin (RL) ELISA Kit

Sign In for Pricing
View Details
Human Reelin (RL) ELISA Kit
MBS451779-03 5x 96 Tests

Human Reelin (RL) ELISA Kit

Sign In for Pricing
View Details
Human Reelin (RL) ELISA Kit
MBS451779-04 10x 96 Tests

Human Reelin (RL) ELISA Kit

Sign In for Pricing
View Details
Recombinant Bordetella bronchiseptica Type IV secretion system protein ptlA homolog (ptlA)
orb2937078-01 20 µg

Recombinant Bordetella bronchiseptica Type IV secretion system protein ptlA homolog (ptlA)

Sign In for Pricing
View Details
Recombinant Bordetella bronchiseptica Type IV secretion system protein ptlA homolog (ptlA)
orb2937078-02 100 µg

Recombinant Bordetella bronchiseptica Type IV secretion system protein ptlA homolog (ptlA)

Sign In for Pricing
View Details