Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

MIRacle™ rno-miR-30d-3p miRNA Agomir/Antagomir

MicroRNA: rno-miR-30d-3p Accession Number: MIMAT0004722 Mature Sequence CUUUCAGUCAGAUGUUUGCUGC rno-miR-30d-3p are small non-coding RNAs of 20-22 nucleotides, typically excised from 60-110 nucleotide foldback RNA precursor structures. miRNAs are involved in crucial biological processes, including development, differentiation, apoptosis, and proliferation, through imperfect pairing with target messenger RNAs (mRNAs) of protein-coding genes and the transcriptional or post-transcriptional regulation of their expression. Click here to browse detailed information about rno-miR-30d-3p in miRBase. What is MicroRNA Agomir/Antagomir? MicroRNA Agomir is a special-labeled and chemically modified double-stranded small RNA that mimics the endogenous miRNA to regulate the biological function of the target gene. MicroRNA Antagomir is an especially chemically modified miRNA antagonist. It strongly competes with mature miRNAs in the body to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning. Why choose rno-miR-30d-3p miRNA Agomir/Antagomir from AcceGen? AcceGen has extended experience in MicroRNA Agomir/Antagomir synthesis services that cover all human, mouse, and rat miRNAs in the current miRBase. Compared to standard miRNA mimics and inhibitors, AcceGen miRNA agomir and antagomir are more resistant to degradation, thus having a lasting effect: minimum for 1 week, up to 5-6 weeks. These products can be used in in vitro or in vivo miRNA functional studies.

Product Specifications

Applications

For research use only

Storage Conditions

Room Temperature

More Discoveries

Explore Other Products

Browse additional items from our catalog

Mouse Monoclonal BST2 Antibody (2E2) [DyLight 594]
NBP2-29621DL594 0.1 mL

Mouse Monoclonal BST2 Antibody (2E2) [DyLight 594]

Sign In for Pricing
View Details
PDSS1 Protein Vector (Human) (pPB-N-His)
PV110327 500 ng

PDSS1 Protein Vector (Human) (pPB-N-His)

Sign In for Pricing
View Details
Complement Component 4 Binding Protein (C4 Binding Protein, C4BP, Complement Component 4 Binding Protein alpha Chain, C4b Binding Protein alpha Chain, C4BPA, Complement Component 4 Binding Protein beta Chain, C4b Binding Protein beta Chain, C4BPB, Proline
MBS6249778-01 0.1 mL

Complement Component 4 Binding Protein (C4 Binding Protein, C4BP, Complement Component 4 Binding Protein alpha Chain, C4b Binding Protein alpha Chain, C4BPA, Complement Component 4 Binding Protein beta Chain, C4b Binding Protein beta Chain, C4BPB, Proline

Sign In for Pricing
View Details
Complement Component 4 Binding Protein (C4 Binding Protein, C4BP, Complement Component 4 Binding Protein alpha Chain, C4b Binding Protein alpha Chain, C4BPA, Complement Component 4 Binding Protein beta Chain, C4b Binding Protein beta Chain, C4BPB, Proline
MBS6249778-02 5x 0.1 mL

Complement Component 4 Binding Protein (C4 Binding Protein, C4BP, Complement Component 4 Binding Protein alpha Chain, C4b Binding Protein alpha Chain, C4BPA, Complement Component 4 Binding Protein beta Chain, C4b Binding Protein beta Chain, C4BPB, Proline

Sign In for Pricing
View Details
SLC35A3 CRISPR Knock Out 293T Cell Line (Human)
44129141 1x 10^6 Cells / 1.0 mL

SLC35A3 CRISPR Knock Out 293T Cell Line (Human)

Sign In for Pricing
View Details
Serpinc1 (NM_080844) Mouse Tagged ORF Clone
MR207423 10 µg

Serpinc1 (NM_080844) Mouse Tagged ORF Clone

Sign In for Pricing
View Details