Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

MIRacle™ rno-miR-30b-5p miRNA Agomir/Antagomir

MicroRNA: rno-miR-30b-5p Accession Number: MIMAT0000806 Mature Sequence UGUAAACAUCCUACACUCAGCU rno-miR-30b-5p are small non-coding RNAs of 20-22 nucleotides, typically excised from 60-110 nucleotide foldback RNA precursor structures. miRNAs are involved in crucial biological processes, including development, differentiation, apoptosis, and proliferation, through imperfect pairing with target messenger RNAs (mRNAs) of protein-coding genes and the transcriptional or post-transcriptional regulation of their expression. Click here to browse detailed information about rno-miR-30b-5p in miRBase. What is MicroRNA Agomir/Antagomir? MicroRNA Agomir is a special-labeled and chemically modified double-stranded small RNA that mimics the endogenous miRNA to regulate the biological function of the target gene. MicroRNA Antagomir is an especially chemically modified miRNA antagonist. It strongly competes with mature miRNAs in the body to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning. Why choose rno-miR-30b-5p miRNA Agomir/Antagomir from AcceGen? AcceGen has extended experience in MicroRNA Agomir/Antagomir synthesis services that cover all human, mouse, and rat miRNAs in the current miRBase. Compared to standard miRNA mimics and inhibitors, AcceGen miRNA agomir and antagomir are more resistant to degradation, thus having a lasting effect: minimum for 1 week, up to 5-6 weeks. These products can be used in in vitro or in vivo miRNA functional studies.

Product Specifications

Applications

For research use only

Storage Conditions

Room Temperature

More Discoveries

Explore Other Products

Browse additional items from our catalog

Lucorafusp Biosimilar (Monoclonal, IgG4)
A138083 100 µL

Lucorafusp Biosimilar (Monoclonal, IgG4)

Sign In for Pricing
View Details
Rabbit Polyclonal AG-2 Antibody [Alexa Fluor 594]
NB110-17780AF594 0.1 mL

Rabbit Polyclonal AG-2 Antibody [Alexa Fluor 594]

Sign In for Pricing
View Details
XRCC6 (X-ray Repair Complementing Defective Repair in Chinese Hamster Cells 6, X Ray Repair Cross-complementing Protein 6, 70kD Subunit of Ku Antigen, Ku70, ATP-dependent DNA Helicase 2 Subunit 1, ATP-dependent DNA Helicase II 70kD Subunit, CTC Box-binding Factor 75kD Subunit, CTC75, CTCBF, 5'-deoxyribose-5-phosphate Lyase Ku70, 5'-dRP Lyase Ku70, DNA Repair Protein XRCC6, G22P1, Lupus Ku Autoantigen Protein p70, ML8, Thyroid-lupus Autoantigen, TLAA) discontinued
X9506-05L 50 µg

XRCC6 (X-ray Repair Complementing Defective Repair in Chinese Hamster Cells 6, X Ray Repair Cross-complementing Protein 6, 70kD Subunit of Ku Antigen, Ku70, ATP-dependent DNA Helicase 2 Subunit 1, ATP-dependent DNA Helicase II 70kD Subunit, CTC Box-binding Factor 75kD Subunit, CTC75, CTCBF, 5'-deoxyribose-5-phosphate Lyase Ku70, 5'-dRP Lyase Ku70, DNA Repair Protein XRCC6, G22P1, Lupus Ku Autoantigen Protein p70, ML8, Thyroid-lupus Autoantigen, TLAA) discontinued

Sign In for Pricing
View Details
METRN Polyclonal Antibody
MBS9234232-01 0.1 mL

METRN Polyclonal Antibody

Sign In for Pricing
View Details
METRN Polyclonal Antibody
MBS9234232-02 5x 0.1 mL

METRN Polyclonal Antibody

Sign In for Pricing
View Details
Aha1p Antibody: ATTO 594
MBS806181-01 0.1 mL

Aha1p Antibody: ATTO 594

Sign In for Pricing
View Details