Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

MIRacle™ rno-miR-29b-5p miRNA Agomir/Antagomir

MicroRNA: rno-miR-29b-5p Accession Number: MIMAT0004717 Mature Sequence CUGGUUUCACAUGGUGGCUUAG rno-miR-29b-5p are small non-coding RNAs of 20-22 nucleotides, typically excised from 60-110 nucleotide foldback RNA precursor structures. miRNAs are involved in crucial biological processes, including development, differentiation, apoptosis, and proliferation, through imperfect pairing with target messenger RNAs (mRNAs) of protein-coding genes and the transcriptional or post-transcriptional regulation of their expression. Click here to browse detailed information about rno-miR-29b-5p in miRBase. What is MicroRNA Agomir/Antagomir? MicroRNA Agomir is a special-labeled and chemically modified double-stranded small RNA that mimics the endogenous miRNA to regulate the biological function of the target gene. MicroRNA Antagomir is an especially chemically modified miRNA antagonist. It strongly competes with mature miRNAs in the body to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning. Why choose rno-miR-29b-5p miRNA Agomir/Antagomir from AcceGen? AcceGen has extended experience in MicroRNA Agomir/Antagomir synthesis services that cover all human, mouse, and rat miRNAs in the current miRBase. Compared to standard miRNA mimics and inhibitors, AcceGen miRNA agomir and antagomir are more resistant to degradation, thus having a lasting effect: minimum for 1 week, up to 5-6 weeks. These products can be used in in vitro or in vivo miRNA functional studies.

Product Specifications

Applications

For research use only

Storage Conditions

Room Temperature

More Discoveries

Explore Other Products

Browse additional items from our catalog

Epstein Barr Virus, Nuclear Antigen (Epstein-Barr Nuclear Antigen 1, EBV Nuclear Antigen 1, EBNA1, EBNA-1, EBV, BKRF1, Human Herpes virus 4, HHV4) (MaxLight 405) discontinued
E3440-11G-ML405 100 µL

Epstein Barr Virus, Nuclear Antigen (Epstein-Barr Nuclear Antigen 1, EBV Nuclear Antigen 1, EBNA1, EBNA-1, EBV, BKRF1, Human Herpes virus 4, HHV4) (MaxLight 405) discontinued

Sign In for Pricing
View Details
Dcp1b Mouse shRNA Plasmid (Locus ID 319618)
TL508242 1 Kit

Dcp1b Mouse shRNA Plasmid (Locus ID 319618)

Sign In for Pricing
View Details
Rabbit Polyclonal ATP5A Antibody
NBP2-38525 0.1 mL

Rabbit Polyclonal ATP5A Antibody

Sign In for Pricing
View Details
Mouse Lymphocyte antigen 96, LY96 GENLISA ELISA
KLM2222 96 Well

Mouse Lymphocyte antigen 96, LY96 GENLISA ELISA

Sign In for Pricing
View Details
Rabbit Polyclonal MTSS1 Antibody [DyLight 755]
NBP3-00067IR 0.1 mL

Rabbit Polyclonal MTSS1 Antibody [DyLight 755]

Sign In for Pricing
View Details
TFRC Recombinant Antibody, FITC Conjugated
bsm-52793R-FITC-01 20 µL

TFRC Recombinant Antibody, FITC Conjugated

Sign In for Pricing
View Details