Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

MIRacle™ rno-miR-3564 miRNA Agomir/Antagomir

MicroRNA: rno-miR-3564 Accession Number: MIMAT0017837 Mature Sequence UGGGAAAUGCAAAGAGGGAAG rno-miR-3564 are small non-coding RNAs of 20-22 nucleotides, typically excised from 60-110 nucleotide foldback RNA precursor structures. miRNAs are involved in crucial biological processes, including development, differentiation, apoptosis, and proliferation, through imperfect pairing with target messenger RNAs (mRNAs) of protein-coding genes and the transcriptional or post-transcriptional regulation of their expression. Click here to browse detailed information about rno-miR-3564 in miRBase. What is MicroRNA Agomir/Antagomir? MicroRNA Agomir is a special-labeled and chemically modified double-stranded small RNA that mimics the endogenous miRNA to regulate the biological function of the target gene. MicroRNA Antagomir is an especially chemically modified miRNA antagonist. It strongly competes with mature miRNAs in the body to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning. Why choose rno-miR-3564 miRNA Agomir/Antagomir from AcceGen? AcceGen has extended experience in MicroRNA Agomir/Antagomir synthesis services that cover all human, mouse, and rat miRNAs in the current miRBase. Compared to standard miRNA mimics and inhibitors, AcceGen miRNA agomir and antagomir are more resistant to degradation, thus having a lasting effect: minimum for 1 week, up to 5-6 weeks. These products can be used in in vitro or in vivo miRNA functional studies.

Product Specifications

Applications

For research use only

Storage Conditions

Room Temperature

More Discoveries

Explore Other Products

Browse additional items from our catalog

Rabbit Tissue factor pathway inhibitor ELISA Kit
ELA-E0394Rb 96 Tests

Rabbit Tissue factor pathway inhibitor ELISA Kit

Sign In for Pricing
View Details
HOXB8 Recombinant Protein (Mouse)
RP142208 100 µg

HOXB8 Recombinant Protein (Mouse)

Sign In for Pricing
View Details
ZNF28 Protein Vector (Human) (pPM-C-HA)
51405021 500 ng

ZNF28 Protein Vector (Human) (pPM-C-HA)

Sign In for Pricing
View Details
SNHG32 Human qPCR Primer Pair (NM_001040438)
HP232051 200 Reactions

SNHG32 Human qPCR Primer Pair (NM_001040438)

Sign In for Pricing
View Details
MRPL28 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 2)
K1329007 1.0 µg DNA

MRPL28 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 2)

Sign In for Pricing
View Details
PRPF40B Protein Vector (Human) (pPM-C-His)
PV113401 500 ng

PRPF40B Protein Vector (Human) (pPM-C-His)

Sign In for Pricing
View Details