Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

MIRacle™ rno-miR-349 miRNA Agomir/Antagomir

MicroRNA: rno-miR-349 Accession Number: MIMAT0000599 Mature Sequence CAGCCCUGCUGUCUUAACCUCU rno-miR-349 are small non-coding RNAs of 20-22 nucleotides, typically excised from 60-110 nucleotide foldback RNA precursor structures. miRNAs are involved in crucial biological processes, including development, differentiation, apoptosis, and proliferation, through imperfect pairing with target messenger RNAs (mRNAs) of protein-coding genes and the transcriptional or post-transcriptional regulation of their expression. Click here to browse detailed information about rno-miR-349 in miRBase. What is MicroRNA Agomir/Antagomir? MicroRNA Agomir is a special-labeled and chemically modified double-stranded small RNA that mimics the endogenous miRNA to regulate the biological function of the target gene. MicroRNA Antagomir is an especially chemically modified miRNA antagonist. It strongly competes with mature miRNAs in the body to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning. Why choose rno-miR-349 miRNA Agomir/Antagomir from AcceGen? AcceGen has extended experience in MicroRNA Agomir/Antagomir synthesis services that cover all human, mouse, and rat miRNAs in the current miRBase. Compared to standard miRNA mimics and inhibitors, AcceGen miRNA agomir and antagomir are more resistant to degradation, thus having a lasting effect: minimum for 1 week, up to 5-6 weeks. These products can be used in in vitro or in vivo miRNA functional studies.

Product Specifications

Applications

For research use only

Storage Conditions

Room Temperature

More Discoveries

Explore Other Products

Browse additional items from our catalog

Lentiviral mouse Hs3st6 shRNA (UAS) - Lentiviral mouse Hs3st6 shRNA (UAS, iRFP) (100)
GTR15264375 1 Vial

Lentiviral mouse Hs3st6 shRNA (UAS) - Lentiviral mouse Hs3st6 shRNA (UAS, iRFP) (100)

Sign In for Pricing
View Details
Rat Hcfc1 Pre-designed siRNA Set A
SI206131A 1 Each

Rat Hcfc1 Pre-designed siRNA Set A

Sign In for Pricing
View Details
BCL7C Polyclonal Antibody, APC-Cy5.5 Conjugated
bs-9763R-APC-Cy5.5 100 µL

BCL7C Polyclonal Antibody, APC-Cy5.5 Conjugated

Sign In for Pricing
View Details
TFEB, ID (TFEB, BHLHE35, Transcription factor EB, Class E basic helix-loop-helix protein 35) (Azide free) (HRP)
MBS6355067-01 0.2 mL

TFEB, ID (TFEB, BHLHE35, Transcription factor EB, Class E basic helix-loop-helix protein 35) (Azide free) (HRP)

Sign In for Pricing
View Details
TFEB, ID (TFEB, BHLHE35, Transcription factor EB, Class E basic helix-loop-helix protein 35) (Azide free) (HRP)
MBS6355067-02 5x 0.2 mL

TFEB, ID (TFEB, BHLHE35, Transcription factor EB, Class E basic helix-loop-helix protein 35) (Azide free) (HRP)

Sign In for Pricing
View Details
CMIP Antibody, Biotin Conjugated
MBS7114205-01 0.05 mg

CMIP Antibody, Biotin Conjugated

Sign In for Pricing
View Details