Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

MIRacle™ rno-miR-653-5p miRNA Agomir/Antagomir

MicroRNA: rno-miR-653-5p Accession Number: MIMAT0012838 Mature Sequence UUGAAACAUUCUCUACUGAAC rno-miR-653-5p are small non-coding RNAs of 20-22 nucleotides, typically excised from 60-110 nucleotide foldback RNA precursor structures. miRNAs are involved in crucial biological processes, including development, differentiation, apoptosis, and proliferation, through imperfect pairing with target messenger RNAs (mRNAs) of protein-coding genes and the transcriptional or post-transcriptional regulation of their expression. Click here to browse detailed information about rno-miR-653-5p in miRBase. What is MicroRNA Agomir/Antagomir? MicroRNA Agomir is a special-labeled and chemically modified double-stranded small RNA that mimics the endogenous miRNA to regulate the biological function of the target gene. MicroRNA Antagomir is an especially chemically modified miRNA antagonist. It strongly competes with mature miRNAs in the body to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning. Why choose rno-miR-653-5p miRNA Agomir/Antagomir from AcceGen? AcceGen has extended experience in MicroRNA Agomir/Antagomir synthesis services that cover all human, mouse, and rat miRNAs in the current miRBase. Compared to standard miRNA mimics and inhibitors, AcceGen miRNA agomir and antagomir are more resistant to degradation, thus having a lasting effect: minimum for 1 week, up to 5-6 weeks. These products can be used in in vitro or in vivo miRNA functional studies.

Product Specifications

Applications

For research use only

Storage Conditions

Room Temperature

More Discoveries

Explore Other Products

Browse additional items from our catalog

Veliparib dihydrochloride 5mg
A21356-5 5 mg

Veliparib dihydrochloride 5mg

Sign In for Pricing
View Details
BTG4 (Protein BTG4, BTG Family Member 4, Protein PC3b, PC3B, MGC33003) (MaxLight 650)
124043-ML650 100 µL

BTG4 (Protein BTG4, BTG Family Member 4, Protein PC3b, PC3B, MGC33003) (MaxLight 650)

Sign In for Pricing
View Details
Clk2 (NM_001014254) Rat Tagged ORF Clone
RR212015 10 µg

Clk2 (NM_001014254) Rat Tagged ORF Clone

Sign In for Pricing
View Details
Lentiviral human CDC42EP1 shRNA (UAS) - Lentiviral human CDC42EP1 shRNA (UAS, iRFP) (25)
GTR15286682 1 Vial

Lentiviral human CDC42EP1 shRNA (UAS) - Lentiviral human CDC42EP1 shRNA (UAS, iRFP) (25)

Sign In for Pricing
View Details
Factor XIIIa Recombinant Rabbit mAb
E43S46927 100 µL

Factor XIIIa Recombinant Rabbit mAb

Sign In for Pricing
View Details
SFRP5 3'UTR GFP Stable Cell Line
TU073032 1.0 mL

SFRP5 3'UTR GFP Stable Cell Line

Sign In for Pricing
View Details