Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

MIRacle™ rno-miR-466d miRNA Agomir/Antagomir

MicroRNA: rno-miR-466d Accession Number: MIMAT0017824 Mature Sequence AUGUGUGUGUAUGUCCUUUUGU rno-miR-466d are small non-coding RNAs of 20-22 nucleotides, typically excised from 60-110 nucleotide foldback RNA precursor structures. miRNAs are involved in crucial biological processes, including development, differentiation, apoptosis, and proliferation, through imperfect pairing with target messenger RNAs (mRNAs) of protein-coding genes and the transcriptional or post-transcriptional regulation of their expression. Click here to browse detailed information about rno-miR-466d in miRBase. What is MicroRNA Agomir/Antagomir? MicroRNA Agomir is a special-labeled and chemically modified double-stranded small RNA that mimics the endogenous miRNA to regulate the biological function of the target gene. MicroRNA Antagomir is an especially chemically modified miRNA antagonist. It strongly competes with mature miRNAs in the body to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning. Why choose rno-miR-466d miRNA Agomir/Antagomir from AcceGen? AcceGen has extended experience in MicroRNA Agomir/Antagomir synthesis services that cover all human, mouse, and rat miRNAs in the current miRBase. Compared to standard miRNA mimics and inhibitors, AcceGen miRNA agomir and antagomir are more resistant to degradation, thus having a lasting effect: minimum for 1 week, up to 5-6 weeks. These products can be used in in vitro or in vivo miRNA functional studies.

Product Specifications

Applications

For research use only

Storage Conditions

Room Temperature

More Discoveries

Explore Other Products

Browse additional items from our catalog

FOXA1 / HNF3A Immunizing Peptide
MBS425143-01 0.1 mg

FOXA1 / HNF3A Immunizing Peptide

Sign In for Pricing
View Details
FOXA1 / HNF3A Immunizing Peptide
MBS425143-02 5x 0.1 mg

FOXA1 / HNF3A Immunizing Peptide

Sign In for Pricing
View Details
RPL13AP12 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 3)
K1906908 1.0 µg DNA

RPL13AP12 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 3)

Sign In for Pricing
View Details
Plxdc2 (NM_001108422) Rat Tagged ORF Clone Lentiviral Particle
RR212457L4V 200 µL

Plxdc2 (NM_001108422) Rat Tagged ORF Clone Lentiviral Particle

Sign In for Pricing
View Details
GPR107 Double Nickase Plasmid (h)
sc-412891-NIC 20 µg

GPR107 Double Nickase Plasmid (h)

Sign In for Pricing
View Details
Anti-Phospho TIE2/TEK (Tyr992) Antibody
B2024252 100 µL

Anti-Phospho TIE2/TEK (Tyr992) Antibody

Sign In for Pricing
View Details