Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

MIRacle™ rno-miR-291b miRNA Agomir/Antagomir

MicroRNA: rno-miR-291b Accession Number: MIMAT0017822 Mature Sequence AAAGUGCAUCCAUUUUGUUAGU rno-miR-291b are small non-coding RNAs of 20-22 nucleotides, typically excised from 60-110 nucleotide foldback RNA precursor structures. miRNAs are involved in crucial biological processes, including development, differentiation, apoptosis, and proliferation, through imperfect pairing with target messenger RNAs (mRNAs) of protein-coding genes and the transcriptional or post-transcriptional regulation of their expression. Click here to browse detailed information about rno-miR-291b in miRBase. What is MicroRNA Agomir/Antagomir? MicroRNA Agomir is a special-labeled and chemically modified double-stranded small RNA that mimics the endogenous miRNA to regulate the biological function of the target gene. MicroRNA Antagomir is an especially chemically modified miRNA antagonist. It strongly competes with mature miRNAs in the body to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning. Why choose rno-miR-291b miRNA Agomir/Antagomir from AcceGen? AcceGen has extended experience in MicroRNA Agomir/Antagomir synthesis services that cover all human, mouse, and rat miRNAs in the current miRBase. Compared to standard miRNA mimics and inhibitors, AcceGen miRNA agomir and antagomir are more resistant to degradation, thus having a lasting effect: minimum for 1 week, up to 5-6 weeks. These products can be used in in vitro or in vivo miRNA functional studies.

Product Specifications

Applications

For research use only

Storage Conditions

Room Temperature

More Discoveries

Explore Other Products

Browse additional items from our catalog

LGALS7, ID (LGALS7, PIG1, Galectin-7, HKL-14, PI7, p53-induced gene 1 protein) (APC)
MBS6315823-01 0.2 mL

LGALS7, ID (LGALS7, PIG1, Galectin-7, HKL-14, PI7, p53-induced gene 1 protein) (APC)

Sign In for Pricing
View Details
LGALS7, ID (LGALS7, PIG1, Galectin-7, HKL-14, PI7, p53-induced gene 1 protein) (APC)
MBS6315823-02 5x 0.2 mL

LGALS7, ID (LGALS7, PIG1, Galectin-7, HKL-14, PI7, p53-induced gene 1 protein) (APC)

Sign In for Pricing
View Details
Plant Death Associated Protein Kinase 3 (DAPK3) ELISA Kit
MBS9375712 Inquire

Plant Death Associated Protein Kinase 3 (DAPK3) ELISA Kit

Sign In for Pricing
View Details
CL029, NT (C12orf29, Uncharacterized protein C12orf29) (MaxLight 405)
MBS6286288-01 0.1 mL

CL029, NT (C12orf29, Uncharacterized protein C12orf29) (MaxLight 405)

Sign In for Pricing
View Details
CL029, NT (C12orf29, Uncharacterized protein C12orf29) (MaxLight 405)
MBS6286288-02 5x 0.1 mL

CL029, NT (C12orf29, Uncharacterized protein C12orf29) (MaxLight 405)

Sign In for Pricing
View Details
Biotinylated Recombinant Human IL-17RA/CD217 Protein
RP02396B-01 100 μg

Biotinylated Recombinant Human IL-17RA/CD217 Protein

Sign In for Pricing
View Details