Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

MIRacle™ rno-miR-291b miRNA Agomir/Antagomir

MicroRNA: rno-miR-291b Accession Number: MIMAT0017822 Mature Sequence AAAGUGCAUCCAUUUUGUUAGU rno-miR-291b are small non-coding RNAs of 20-22 nucleotides, typically excised from 60-110 nucleotide foldback RNA precursor structures. miRNAs are involved in crucial biological processes, including development, differentiation, apoptosis, and proliferation, through imperfect pairing with target messenger RNAs (mRNAs) of protein-coding genes and the transcriptional or post-transcriptional regulation of their expression. Click here to browse detailed information about rno-miR-291b in miRBase. What is MicroRNA Agomir/Antagomir? MicroRNA Agomir is a special-labeled and chemically modified double-stranded small RNA that mimics the endogenous miRNA to regulate the biological function of the target gene. MicroRNA Antagomir is an especially chemically modified miRNA antagonist. It strongly competes with mature miRNAs in the body to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning. Why choose rno-miR-291b miRNA Agomir/Antagomir from AcceGen? AcceGen has extended experience in MicroRNA Agomir/Antagomir synthesis services that cover all human, mouse, and rat miRNAs in the current miRBase. Compared to standard miRNA mimics and inhibitors, AcceGen miRNA agomir and antagomir are more resistant to degradation, thus having a lasting effect: minimum for 1 week, up to 5-6 weeks. These products can be used in in vitro or in vivo miRNA functional studies.

Product Specifications

Applications

For research use only

Storage Conditions

Room Temperature

More Discoveries

Explore Other Products

Browse additional items from our catalog

Mouse Anti-TTR Recombinant Antibody (EC261)
V2LY-0613-LY261 Each

Mouse Anti-TTR Recombinant Antibody (EC261)

Sign In for Pricing
View Details
LYSMD1 antibody - N-terminal region
MBS3212525-01 0.1 mL

LYSMD1 antibody - N-terminal region

Sign In for Pricing
View Details
LYSMD1 antibody - N-terminal region
MBS3212525-02 5x 0.1 mL

LYSMD1 antibody - N-terminal region

Sign In for Pricing
View Details
B7-H1 Antibody / B7 homolog 1 / PD-L1 / CD274
V5293SAF-100UG 100 µg

B7-H1 Antibody / B7 homolog 1 / PD-L1 / CD274

Sign In for Pricing
View Details
Mouse Monoclonal IL-15 Antibody (34559) [DyLight 550]
FAB2471L 0.1 mL

Mouse Monoclonal IL-15 Antibody (34559) [DyLight 550]

Sign In for Pricing
View Details
Rabbit Polyclonal MYLK4 Antibody [DyLight 350]
NBP2-98058UV 0.1 mL

Rabbit Polyclonal MYLK4 Antibody [DyLight 350]

Sign In for Pricing
View Details