Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

MIRacle™ rno-miR-504 miRNA Agomir/Antagomir

MicroRNA: rno-miR-504 Accession Number: MIMAT0012830 Mature Sequence AGACCCUGGUCUGCACUCUGUC rno-miR-504 are small non-coding RNAs of 20-22 nucleotides, typically excised from 60-110 nucleotide foldback RNA precursor structures. miRNAs are involved in crucial biological processes, including development, differentiation, apoptosis, and proliferation, through imperfect pairing with target messenger RNAs (mRNAs) of protein-coding genes and the transcriptional or post-transcriptional regulation of their expression. Click here to browse detailed information about rno-miR-504 in miRBase. What is MicroRNA Agomir/Antagomir? MicroRNA Agomir is a special-labeled and chemically modified double-stranded small RNA that mimics the endogenous miRNA to regulate the biological function of the target gene. MicroRNA Antagomir is an especially chemically modified miRNA antagonist. It strongly competes with mature miRNAs in the body to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning. Why choose rno-miR-504 miRNA Agomir/Antagomir from AcceGen? AcceGen has extended experience in MicroRNA Agomir/Antagomir synthesis services that cover all human, mouse, and rat miRNAs in the current miRBase. Compared to standard miRNA mimics and inhibitors, AcceGen miRNA agomir and antagomir are more resistant to degradation, thus having a lasting effect: minimum for 1 week, up to 5-6 weeks. These products can be used in in vitro or in vivo miRNA functional studies.

Product Specifications

Applications

For research use only

Storage Conditions

Room Temperature

More Discoveries

Explore Other Products

Browse additional items from our catalog

Rabbit anti-OTUB2 Antibody
YLD5756-01 50 µL

Rabbit anti-OTUB2 Antibody

Sign In for Pricing
View Details
Rabbit anti-OTUB2 Antibody
YLD5756-02 100 µL

Rabbit anti-OTUB2 Antibody

Sign In for Pricing
View Details
Rabbit Microglia Medium
ARM0857 500 mL

Rabbit Microglia Medium

Sign In for Pricing
View Details
SH3BP1 CRISPRa sgRNA lentivector (set of three targets)(Human)
43666121 3x 1.0µg DNA

SH3BP1 CRISPRa sgRNA lentivector (set of three targets)(Human)

Sign In for Pricing
View Details
Epimedin A
C14113 1 mg

Epimedin A

Sign In for Pricing
View Details
IFI35 Mouse Monoclonal Antibody [Clone ID: OTI2H5]
TA503361S 30 µL

IFI35 Mouse Monoclonal Antibody [Clone ID: OTI2H5]

Sign In for Pricing
View Details