Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

MIRacle™ rno-miR-184 miRNA Agomir/Antagomir

MicroRNA: rno-miR-184 Accession Number: MIMAT0000861 Mature Sequence UGGACGGAGAACUGAUAAGGGU rno-miR-184 are small non-coding RNAs of 20-22 nucleotides, typically excised from 60-110 nucleotide foldback RNA precursor structures. miRNAs are involved in crucial biological processes, including development, differentiation, apoptosis, and proliferation, through imperfect pairing with target messenger RNAs (mRNAs) of protein-coding genes and the transcriptional or post-transcriptional regulation of their expression. Click here to browse detailed information about rno-miR-184 in miRBase. What is MicroRNA Agomir/Antagomir? MicroRNA Agomir is a special-labeled and chemically modified double-stranded small RNA that mimics the endogenous miRNA to regulate the biological function of the target gene. MicroRNA Antagomir is an especially chemically modified miRNA antagonist. It strongly competes with mature miRNAs in the body to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning. Why choose rno-miR-184 miRNA Agomir/Antagomir from AcceGen? AcceGen has extended experience in MicroRNA Agomir/Antagomir synthesis services that cover all human, mouse, and rat miRNAs in the current miRBase. Compared to standard miRNA mimics and inhibitors, AcceGen miRNA agomir and antagomir are more resistant to degradation, thus having a lasting effect: minimum for 1 week, up to 5-6 weeks. These products can be used in in vitro or in vivo miRNA functional studies.

Product Specifications

Applications

For research use only

Storage Conditions

Room Temperature

Frequently Asked Questions

More Discoveries

Explore Other Products

Browse additional items from our catalog

MM 4-64 Fixable Membrane Stain
21488-AAT 5x 100 µg

MM 4-64 Fixable Membrane Stain

Sign In for Pricing
View Details
RPAIN Mouse Monoclonal Antibody (HRP conjugated) [Clone ID: OTI3E6]
TA810498BM 100 µL

RPAIN Mouse Monoclonal Antibody (HRP conjugated) [Clone ID: OTI3E6]

Sign In for Pricing
View Details
Desmin (Muscle Cell Marker) (DES/2960R), CF405S conjugate, 0.1mg/mL
BNC042960-500 1x 500 µL

Desmin (Muscle Cell Marker) (DES/2960R), CF405S conjugate, 0.1mg/mL

Sign In for Pricing
View Details
Ugt2b36 Mouse Gene Knockout Kit (CRISPR)
KN518677 1 Kit

Ugt2b36 Mouse Gene Knockout Kit (CRISPR)

Sign In for Pricing
View Details
Human SLC35B3 activation kit by CRISPRa
GA109485 1 Kit

Human SLC35B3 activation kit by CRISPRa

Sign In for Pricing
View Details
T Cell Receptor (TCR) gamma/delta Hamster Monoclonal Antibody [Clone ID: UC7-13D5]
AM08059PU-N 500 µg

T Cell Receptor (TCR) gamma/delta Hamster Monoclonal Antibody [Clone ID: UC7-13D5]

Sign In for Pricing
View Details