Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

MIRacle™ rno-miR-149-5p miRNA Agomir/Antagomir

MicroRNA: rno-miR-149-5p Accession Number: MIMAT0035726 Mature Sequence UCUGGCUCCGUGUCUUCACUCCC rno-miR-149-5p are small non-coding RNAs of 20-22 nucleotides, typically excised from 60-110 nucleotide foldback RNA precursor structures. miRNAs are involved in crucial biological processes, including development, differentiation, apoptosis, and proliferation, through imperfect pairing with target messenger RNAs (mRNAs) of protein-coding genes and the transcriptional or post-transcriptional regulation of their expression. Click here to browse detailed information about rno-miR-149-5p in miRBase. What is MicroRNA Agomir/Antagomir? MicroRNA Agomir is a special-labeled and chemically modified double-stranded small RNA that mimics the endogenous miRNA to regulate the biological function of the target gene. MicroRNA Antagomir is an especially chemically modified miRNA antagonist. It strongly competes with mature miRNAs in the body to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning. Why choose rno-miR-149-5p miRNA Agomir/Antagomir from AcceGen? AcceGen has extended experience in MicroRNA Agomir/Antagomir synthesis services that cover all human, mouse, and rat miRNAs in the current miRBase. Compared to standard miRNA mimics and inhibitors, AcceGen miRNA agomir and antagomir are more resistant to degradation, thus having a lasting effect: minimum for 1 week, up to 5-6 weeks. These products can be used in in vitro or in vivo miRNA functional studies.

Product Specifications

Applications

For research use only

Storage Conditions

Room Temperature

More Discoveries

Explore Other Products

Browse additional items from our catalog

Mouse Stat5b (Signal transducer and activator of transcription 5B) ELISA Kit
EM8274 96 Tests

Mouse Stat5b (Signal transducer and activator of transcription 5B) ELISA Kit

Sign In for Pricing
View Details
LOXL3 Double Nickase Plasmid (h)
sc-402967-NIC 20 µg

LOXL3 Double Nickase Plasmid (h)

Sign In for Pricing
View Details
Rat Egr4 ELISA Kit
ELI-47061r 96 Tests

Rat Egr4 ELISA Kit

Sign In for Pricing
View Details
Rabbit Monoclonal CD63 Antibody (LAMP3/8678R)
NBP3-23647-20ug 20 µg

Rabbit Monoclonal CD63 Antibody (LAMP3/8678R)

Sign In for Pricing
View Details
Gtf2b Rat shRNA Lentiviral Particle (Locus ID 81673)
TL711172V 500 µL Each

Gtf2b Rat shRNA Lentiviral Particle (Locus ID 81673)

Sign In for Pricing
View Details
pDynlt1-Fluc-SV40-hRluc-Neo Plasmid
PVT61356 2 µg

pDynlt1-Fluc-SV40-hRluc-Neo Plasmid

Sign In for Pricing
View Details