Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

MIRacle™ rno-miR-149-5p miRNA Agomir/Antagomir

MicroRNA: rno-miR-149-5p Accession Number: MIMAT0035726 Mature Sequence UCUGGCUCCGUGUCUUCACUCCC rno-miR-149-5p are small non-coding RNAs of 20-22 nucleotides, typically excised from 60-110 nucleotide foldback RNA precursor structures. miRNAs are involved in crucial biological processes, including development, differentiation, apoptosis, and proliferation, through imperfect pairing with target messenger RNAs (mRNAs) of protein-coding genes and the transcriptional or post-transcriptional regulation of their expression. Click here to browse detailed information about rno-miR-149-5p in miRBase. What is MicroRNA Agomir/Antagomir? MicroRNA Agomir is a special-labeled and chemically modified double-stranded small RNA that mimics the endogenous miRNA to regulate the biological function of the target gene. MicroRNA Antagomir is an especially chemically modified miRNA antagonist. It strongly competes with mature miRNAs in the body to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning. Why choose rno-miR-149-5p miRNA Agomir/Antagomir from AcceGen? AcceGen has extended experience in MicroRNA Agomir/Antagomir synthesis services that cover all human, mouse, and rat miRNAs in the current miRBase. Compared to standard miRNA mimics and inhibitors, AcceGen miRNA agomir and antagomir are more resistant to degradation, thus having a lasting effect: minimum for 1 week, up to 5-6 weeks. These products can be used in in vitro or in vivo miRNA functional studies.

Product Specifications

Applications

For research use only

Storage Conditions

Room Temperature

More Discoveries

Explore Other Products

Browse additional items from our catalog

CCKBR (NM_176875) Human Tagged ORF Clone
RG200676 10 µg

CCKBR (NM_176875) Human Tagged ORF Clone

Sign In for Pricing
View Details
BNIP3L (BCL2/Adenovirus E1B 19kD Protein-Interacting Protein 3-like) (Biotin) discontinued
214547-Biotin 100 µL

BNIP3L (BCL2/Adenovirus E1B 19kD Protein-Interacting Protein 3-like) (Biotin) discontinued

Sign In for Pricing
View Details
Mouse Slc35f4 qPCR Primer Pair
QM43754S 200 Tests

Mouse Slc35f4 qPCR Primer Pair

Sign In for Pricing
View Details
CHRAC15 discontinued
342518-01 100 µL

CHRAC15 discontinued

Sign In for Pricing
View Details
CHRAC15 discontinued
342518-02 200 µL

CHRAC15 discontinued

Sign In for Pricing
View Details
Rnf41 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)
K4828405 3x 1.0 µg

Rnf41 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)

Sign In for Pricing
View Details