Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

MIRacle™ rno-miR-105 miRNA Agomir/Antagomir

MicroRNA: rno-miR-105 Accession Number: MIMAT0012825 Mature Sequence CAAGUGCUCAGAUGUCUGUGGU rno-miR-105 are small non-coding RNAs of 20-22 nucleotides, typically excised from 60-110 nucleotide foldback RNA precursor structures. miRNAs are involved in crucial biological processes, including development, differentiation, apoptosis, and proliferation, through imperfect pairing with target messenger RNAs (mRNAs) of protein-coding genes and the transcriptional or post-transcriptional regulation of their expression. Click here to browse detailed information about rno-miR-105 in miRBase. What is MicroRNA Agomir/Antagomir? MicroRNA Agomir is a special-labeled and chemically modified double-stranded small RNA that mimics the endogenous miRNA to regulate the biological function of the target gene. MicroRNA Antagomir is an especially chemically modified miRNA antagonist. It strongly competes with mature miRNAs in the body to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning. Why choose rno-miR-105 miRNA Agomir/Antagomir from AcceGen? AcceGen has extended experience in MicroRNA Agomir/Antagomir synthesis services that cover all human, mouse, and rat miRNAs in the current miRBase. Compared to standard miRNA mimics and inhibitors, AcceGen miRNA agomir and antagomir are more resistant to degradation, thus having a lasting effect: minimum for 1 week, up to 5-6 weeks. These products can be used in in vitro or in vivo miRNA functional studies.

Product Specifications

Applications

For research use only

Storage Conditions

Room Temperature

More Discoveries

Explore Other Products

Browse additional items from our catalog

IL22RA1 (Interleukin-22 Receptor Subunit alpha-1, IL-22 Receptor Subunit alpha-1, IL-22R-alpha-1, IL-22RA1, Cytokine Receptor Class-II Member 9, Cytokine Receptor Family 2 Member 9, CRF2-9, ZcytoR11, IL22R) (HRP)
MBS6153069-01 0.1 mL

IL22RA1 (Interleukin-22 Receptor Subunit alpha-1, IL-22 Receptor Subunit alpha-1, IL-22R-alpha-1, IL-22RA1, Cytokine Receptor Class-II Member 9, Cytokine Receptor Family 2 Member 9, CRF2-9, ZcytoR11, IL22R) (HRP)

Sign In for Pricing
View Details
IL22RA1 (Interleukin-22 Receptor Subunit alpha-1, IL-22 Receptor Subunit alpha-1, IL-22R-alpha-1, IL-22RA1, Cytokine Receptor Class-II Member 9, Cytokine Receptor Family 2 Member 9, CRF2-9, ZcytoR11, IL22R) (HRP)
MBS6153069-02 5x 0.1 mL

IL22RA1 (Interleukin-22 Receptor Subunit alpha-1, IL-22 Receptor Subunit alpha-1, IL-22R-alpha-1, IL-22RA1, Cytokine Receptor Class-II Member 9, Cytokine Receptor Family 2 Member 9, CRF2-9, ZcytoR11, IL22R) (HRP)

Sign In for Pricing
View Details
Cxxc1 (NM_001079698) Rat Tagged Lenti ORF Clone
RR205609L3 10 µg

Cxxc1 (NM_001079698) Rat Tagged Lenti ORF Clone

Sign In for Pricing
View Details
mmu-miR-483 Primers
MPM00543 150 µL - 10 µM

mmu-miR-483 Primers

Sign In for Pricing
View Details
Lentiviral mouse Sirt4 shRNA (UAS) - Lentiviral mouse Sirt4 shRNA (UAS, GFP) (100)
GTR15259557 1 Vial

Lentiviral mouse Sirt4 shRNA (UAS) - Lentiviral mouse Sirt4 shRNA (UAS, GFP) (100)

Sign In for Pricing
View Details
Human anti-nucleolus antibody ELISA Kit
MBS269018-01 48 Well

Human anti-nucleolus antibody ELISA Kit

Sign In for Pricing
View Details