Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

MIRacle™ rno-miR-335 miRNA Agomir/Antagomir

MicroRNA: rno-miR-335 Accession Number: MIMAT0000575 Mature Sequence UCAAGAGCAAUAACGAAAAAUGU rno-miR-335 are small non-coding RNAs of 20-22 nucleotides, typically excised from 60-110 nucleotide foldback RNA precursor structures. miRNAs are involved in crucial biological processes, including development, differentiation, apoptosis, and proliferation, through imperfect pairing with target messenger RNAs (mRNAs) of protein-coding genes and the transcriptional or post-transcriptional regulation of their expression. Click here to browse detailed information about rno-miR-335 in miRBase. What is MicroRNA Agomir/Antagomir? MicroRNA Agomir is a special-labeled and chemically modified double-stranded small RNA that mimics the endogenous miRNA to regulate the biological function of the target gene. MicroRNA Antagomir is an especially chemically modified miRNA antagonist. It strongly competes with mature miRNAs in the body to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning. Why choose rno-miR-335 miRNA Agomir/Antagomir from AcceGen? AcceGen has extended experience in MicroRNA Agomir/Antagomir synthesis services that cover all human, mouse, and rat miRNAs in the current miRBase. Compared to standard miRNA mimics and inhibitors, AcceGen miRNA agomir and antagomir are more resistant to degradation, thus having a lasting effect: minimum for 1 week, up to 5-6 weeks. These products can be used in in vitro or in vivo miRNA functional studies.

Product Specifications

Applications

For research use only

Storage Conditions

Room Temperature

More Discoveries

Explore Other Products

Browse additional items from our catalog

ASPH (Aspartyl/Asparaginyl beta-hydroxylase, Aspartate beta-hydroxylase, ASP beta-hydroxylase, Peptide-aspartate beta-dioxygenase) (MaxLight 405) discontinued
123640-ML405 100 µL

ASPH (Aspartyl/Asparaginyl beta-hydroxylase, Aspartate beta-hydroxylase, ASP beta-hydroxylase, Peptide-aspartate beta-dioxygenase) (MaxLight 405) discontinued

Sign In for Pricing
View Details
C1S (C1 esterase, Complement C1s subComponent, Complement C1s subComponent Heavy Chain, Complement C1s subComponent Light Chain, Complement Component 1 s subComponent) discontinued
221222-01 50 µL

C1S (C1 esterase, Complement C1s subComponent, Complement C1s subComponent Heavy Chain, Complement C1s subComponent Light Chain, Complement Component 1 s subComponent) discontinued

Sign In for Pricing
View Details
C1S (C1 esterase, Complement C1s subComponent, Complement C1s subComponent Heavy Chain, Complement C1s subComponent Light Chain, Complement Component 1 s subComponent) discontinued
221222-02 100 µL

C1S (C1 esterase, Complement C1s subComponent, Complement C1s subComponent Heavy Chain, Complement C1s subComponent Light Chain, Complement Component 1 s subComponent) discontinued

Sign In for Pricing
View Details
Porcine ADP-ribosylation factor-like protein 11 (ARL11) ELISA Kit
MBS7230777-01 48 Well

Porcine ADP-ribosylation factor-like protein 11 (ARL11) ELISA Kit

Sign In for Pricing
View Details
Porcine ADP-ribosylation factor-like protein 11 (ARL11) ELISA Kit
MBS7230777-02 96 Well

Porcine ADP-ribosylation factor-like protein 11 (ARL11) ELISA Kit

Sign In for Pricing
View Details
Porcine ADP-ribosylation factor-like protein 11 (ARL11) ELISA Kit
MBS7230777-03 5x 96 Well

Porcine ADP-ribosylation factor-like protein 11 (ARL11) ELISA Kit

Sign In for Pricing
View Details