Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

MIRacle™ rno-miR-335 miRNA Agomir/Antagomir

MicroRNA: rno-miR-335 Accession Number: MIMAT0000575 Mature Sequence UCAAGAGCAAUAACGAAAAAUGU rno-miR-335 are small non-coding RNAs of 20-22 nucleotides, typically excised from 60-110 nucleotide foldback RNA precursor structures. miRNAs are involved in crucial biological processes, including development, differentiation, apoptosis, and proliferation, through imperfect pairing with target messenger RNAs (mRNAs) of protein-coding genes and the transcriptional or post-transcriptional regulation of their expression. Click here to browse detailed information about rno-miR-335 in miRBase. What is MicroRNA Agomir/Antagomir? MicroRNA Agomir is a special-labeled and chemically modified double-stranded small RNA that mimics the endogenous miRNA to regulate the biological function of the target gene. MicroRNA Antagomir is an especially chemically modified miRNA antagonist. It strongly competes with mature miRNAs in the body to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning. Why choose rno-miR-335 miRNA Agomir/Antagomir from AcceGen? AcceGen has extended experience in MicroRNA Agomir/Antagomir synthesis services that cover all human, mouse, and rat miRNAs in the current miRBase. Compared to standard miRNA mimics and inhibitors, AcceGen miRNA agomir and antagomir are more resistant to degradation, thus having a lasting effect: minimum for 1 week, up to 5-6 weeks. These products can be used in in vitro or in vivo miRNA functional studies.

Product Specifications

Applications

For research use only

Storage Conditions

Room Temperature

More Discoveries

Explore Other Products

Browse additional items from our catalog

TOP1P1 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)
K2424205 3x 1.0 µg

TOP1P1 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)

Sign In for Pricing
View Details
Colloidal Gold Conjugated Cicer arietinum Lectin (Chick Pea) -CPA-,  20nm
GP-6601-20 1 mL

Colloidal Gold Conjugated Cicer arietinum Lectin (Chick Pea) -CPA-, 20nm

Sign In for Pricing
View Details
RT1-N1 3'UTR Lenti-reporter-Luc Vector
42846086 1.0 µg

RT1-N1 3'UTR Lenti-reporter-Luc Vector

Sign In for Pricing
View Details
UCRC (Ubiquinol-cytochrome c Reductase Complex 7.2kD Protein, UQCR10, Cytochrome b-c1 Complex Subunit 9, Complex III Subunit 9, Complex III Subunit X, Cytochrome c1 Non-heme 7kD Protein, HSPC119) (PE)
MBS6160964-01 0.1 mL

UCRC (Ubiquinol-cytochrome c Reductase Complex 7.2kD Protein, UQCR10, Cytochrome b-c1 Complex Subunit 9, Complex III Subunit 9, Complex III Subunit X, Cytochrome c1 Non-heme 7kD Protein, HSPC119) (PE)

Sign In for Pricing
View Details
UCRC (Ubiquinol-cytochrome c Reductase Complex 7.2kD Protein, UQCR10, Cytochrome b-c1 Complex Subunit 9, Complex III Subunit 9, Complex III Subunit X, Cytochrome c1 Non-heme 7kD Protein, HSPC119) (PE)
MBS6160964-02 5x 0.1 mL

UCRC (Ubiquinol-cytochrome c Reductase Complex 7.2kD Protein, UQCR10, Cytochrome b-c1 Complex Subunit 9, Complex III Subunit 9, Complex III Subunit X, Cytochrome c1 Non-heme 7kD Protein, HSPC119) (PE)

Sign In for Pricing
View Details
BAHCC1 sgRNA CRISPR Lentivector (Human) (Target 3)
K0167704 1.0 µg DNA

BAHCC1 sgRNA CRISPR Lentivector (Human) (Target 3)

Sign In for Pricing
View Details