Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

MIRacle™ rno-miR-6326 miRNA Agomir/Antagomir

MicroRNA: rno-miR-6326 Accession Number: MIMAT0025065 Mature Sequence CUGGUCUGUAAAGGGACACAGCA rno-miR-6326 are small non-coding RNAs of 20-22 nucleotides, typically excised from 60-110 nucleotide foldback RNA precursor structures. miRNAs are involved in crucial biological processes, including development, differentiation, apoptosis, and proliferation, through imperfect pairing with target messenger RNAs (mRNAs) of protein-coding genes and the transcriptional or post-transcriptional regulation of their expression. Click here to browse detailed information about rno-miR-6326 in miRBase. What is MicroRNA Agomir/Antagomir? MicroRNA Agomir is a special-labeled and chemically modified double-stranded small RNA that mimics the endogenous miRNA to regulate the biological function of the target gene. MicroRNA Antagomir is an especially chemically modified miRNA antagonist. It strongly competes with mature miRNAs in the body to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning. Why choose rno-miR-6326 miRNA Agomir/Antagomir from AcceGen? AcceGen has extended experience in MicroRNA Agomir/Antagomir synthesis services that cover all human, mouse, and rat miRNAs in the current miRBase. Compared to standard miRNA mimics and inhibitors, AcceGen miRNA agomir and antagomir are more resistant to degradation, thus having a lasting effect: minimum for 1 week, up to 5-6 weeks. These products can be used in in vitro or in vivo miRNA functional studies.

Product Specifications

Applications

For research use only

Storage Conditions

Room Temperature

More Discoveries

Explore Other Products

Browse additional items from our catalog

Rsrc1 (BC038303) Mouse Tagged ORF Clone Lentiviral Particle
MR203799L3V 200 µL

Rsrc1 (BC038303) Mouse Tagged ORF Clone Lentiviral Particle

Sign In for Pricing
View Details
BRAF Rabbit Polyclonal Antibody
MBS9464284-01 0.05 mL

BRAF Rabbit Polyclonal Antibody

Sign In for Pricing
View Details
BRAF Rabbit Polyclonal Antibody
MBS9464284-02 0.1 mL

BRAF Rabbit Polyclonal Antibody

Sign In for Pricing
View Details
BRAF Rabbit Polyclonal Antibody
MBS9464284-03 5x 0.1 mL

BRAF Rabbit Polyclonal Antibody

Sign In for Pricing
View Details
PROCAP DYKDDDDK-Agarose IP/CoIP KIT
PFA025 25 Tests

PROCAP DYKDDDDK-Agarose IP/CoIP KIT

Sign In for Pricing
View Details
Anti-Hu CD10 APC-Cyanine7
MBS1801285-01 100 Tests

Anti-Hu CD10 APC-Cyanine7

Sign In for Pricing
View Details