Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

MIRacle™ rno-miR-6325 miRNA Agomir/Antagomir

MicroRNA: rno-miR-6325 Accession Number: MIMAT0025064 Mature Sequence AAAGUCAGACAGAGACUCUGCAG rno-miR-6325 are small non-coding RNAs of 20-22 nucleotides, typically excised from 60-110 nucleotide foldback RNA precursor structures. miRNAs are involved in crucial biological processes, including development, differentiation, apoptosis, and proliferation, through imperfect pairing with target messenger RNAs (mRNAs) of protein-coding genes and the transcriptional or post-transcriptional regulation of their expression. Click here to browse detailed information about rno-miR-6325 in miRBase. What is MicroRNA Agomir/Antagomir? MicroRNA Agomir is a special-labeled and chemically modified double-stranded small RNA that mimics the endogenous miRNA to regulate the biological function of the target gene. MicroRNA Antagomir is an especially chemically modified miRNA antagonist. It strongly competes with mature miRNAs in the body to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning. Why choose rno-miR-6325 miRNA Agomir/Antagomir from AcceGen? AcceGen has extended experience in MicroRNA Agomir/Antagomir synthesis services that cover all human, mouse, and rat miRNAs in the current miRBase. Compared to standard miRNA mimics and inhibitors, AcceGen miRNA agomir and antagomir are more resistant to degradation, thus having a lasting effect: minimum for 1 week, up to 5-6 weeks. These products can be used in in vitro or in vivo miRNA functional studies.

Product Specifications

Applications

For research use only

Storage Conditions

Room Temperature

More Discoveries

Explore Other Products

Browse additional items from our catalog

Rabbit anti-Escherichia coli O81 (strain ED1a) YQGE Polyclonal Antibody
MBS7174095 Inquire

Rabbit anti-Escherichia coli O81 (strain ED1a) YQGE Polyclonal Antibody

Sign In for Pricing
View Details
Echinosporin
E088-2.5MG 2.5 mg

Echinosporin

Sign In for Pricing
View Details
Human RRAS2 Pre-designed siRNA Set A
SI014095A 1 Each

Human RRAS2 Pre-designed siRNA Set A

Sign In for Pricing
View Details
CYP2D6 (Debrisoquine 4-hydroxylase, Cytochrome P450-DB1, CYPIID6, Cytochrome P450 2D6, CYP2DL1)
125579 100 µg

CYP2D6 (Debrisoquine 4-hydroxylase, Cytochrome P450-DB1, CYPIID6, Cytochrome P450 2D6, CYP2DL1)

Sign In for Pricing
View Details
Mouse UROS shRNA Plasmid
abx973331-01 150 µg

Mouse UROS shRNA Plasmid

Sign In for Pricing
View Details
Mouse UROS shRNA Plasmid
abx973331-02 300 µg

Mouse UROS shRNA Plasmid

Sign In for Pricing
View Details