Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

MIRacle™ rno-miR-6322 miRNA Agomir/Antagomir

MicroRNA: rno-miR-6322 Accession Number: MIMAT0025061 Mature Sequence UGUCUGUACCACAUGGCACGGU rno-miR-6322 are small non-coding RNAs of 20-22 nucleotides, typically excised from 60-110 nucleotide foldback RNA precursor structures. miRNAs are involved in crucial biological processes, including development, differentiation, apoptosis, and proliferation, through imperfect pairing with target messenger RNAs (mRNAs) of protein-coding genes and the transcriptional or post-transcriptional regulation of their expression. Click here to browse detailed information about rno-miR-6322 in miRBase. What is MicroRNA Agomir/Antagomir? MicroRNA Agomir is a special-labeled and chemically modified double-stranded small RNA that mimics the endogenous miRNA to regulate the biological function of the target gene. MicroRNA Antagomir is an especially chemically modified miRNA antagonist. It strongly competes with mature miRNAs in the body to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning. Why choose rno-miR-6322 miRNA Agomir/Antagomir from AcceGen? AcceGen has extended experience in MicroRNA Agomir/Antagomir synthesis services that cover all human, mouse, and rat miRNAs in the current miRBase. Compared to standard miRNA mimics and inhibitors, AcceGen miRNA agomir and antagomir are more resistant to degradation, thus having a lasting effect: minimum for 1 week, up to 5-6 weeks. These products can be used in in vitro or in vivo miRNA functional studies.

Product Specifications

Applications

For research use only

Storage Conditions

Room Temperature

More Discoveries

Explore Other Products

Browse additional items from our catalog

EG381806 (BC061166) Mouse Tagged Lenti ORF Clone
MR203436L4 10 µg

EG381806 (BC061166) Mouse Tagged Lenti ORF Clone

Sign In for Pricing
View Details
RBM12 (KIAA0765, RNA-binding Protein 12, RNA-binding Motif Protein 12, SH3/WW Domain Anchor Protein in the Nucleus) (AP) discontinued
132387-AP 100 µL

RBM12 (KIAA0765, RNA-binding Protein 12, RNA-binding Motif Protein 12, SH3/WW Domain Anchor Protein in the Nucleus) (AP) discontinued

Sign In for Pricing
View Details
Gastrin/Cholecystokinin Type B Receptor (CCKBR) BioAssayTM ELISA Kit (Human) discontinued
587611 96 Tests

Gastrin/Cholecystokinin Type B Receptor (CCKBR) BioAssayTM ELISA Kit (Human) discontinued

Sign In for Pricing
View Details
PAX1, CT (PAX1, HUP48, Paired box protein Pax-1, HuP48) (APC)
MBS6331122-01 0.2 mL

PAX1, CT (PAX1, HUP48, Paired box protein Pax-1, HuP48) (APC)

Sign In for Pricing
View Details
PAX1, CT (PAX1, HUP48, Paired box protein Pax-1, HuP48) (APC)
MBS6331122-02 5x 0.2 mL

PAX1, CT (PAX1, HUP48, Paired box protein Pax-1, HuP48) (APC)

Sign In for Pricing
View Details
Recombinant Periostin (POSTN)
SIPH997Ra02-01 10 µg

Recombinant Periostin (POSTN)

Sign In for Pricing
View Details