Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

MIRacle™ rno-let-7f-5p miRNA Agomir/Antagomir

MicroRNA: rno-let-7f-5p Accession Number: MIMAT0000778 Mature Sequence UGAGGUAGUAGAUUGUAUAGUU rno-let-7f-5p are small non-coding RNAs of 20-22 nucleotides, typically excised from 60-110 nucleotide foldback RNA precursor structures. miRNAs are involved in crucial biological processes, including development, differentiation, apoptosis, and proliferation, through imperfect pairing with target messenger RNAs (mRNAs) of protein-coding genes and the transcriptional or post-transcriptional regulation of their expression. Click here to browse detailed information about rno-let-7f-5p in miRBase. What is MicroRNA Agomir/Antagomir? MicroRNA Agomir is a special-labeled and chemically modified double-stranded small RNA that mimics the endogenous miRNA to regulate the biological function of the target gene. MicroRNA Antagomir is an especially chemically modified miRNA antagonist. It strongly competes with mature miRNAs in the body to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning. Why choose rno-let-7f-5p miRNA Agomir/Antagomir from AcceGen? AcceGen has extended experience in MicroRNA Agomir/Antagomir synthesis services that cover all human, mouse, and rat miRNAs in the current miRBase. Compared to standard miRNA mimics and inhibitors, AcceGen miRNA agomir and antagomir are more resistant to degradation, thus having a lasting effect: minimum for 1 week, up to 5-6 weeks. These products can be used in in vitro or in vivo miRNA functional studies.

Product Specifications

Applications

For research use only

Storage Conditions

Room Temperature

More Discoveries

Explore Other Products

Browse additional items from our catalog

VPS39-set siRNA/shRNA/RNAi Lentivector (Human)
50188091 4x 500 ng

VPS39-set siRNA/shRNA/RNAi Lentivector (Human)

Sign In for Pricing
View Details
Parkin Cell-Based ELISA Kit
CB5534 1 Kit

Parkin Cell-Based ELISA Kit

Sign In for Pricing
View Details
SNTN Protein Vector (Rat) (pPM-C-HA)
45014026 500 ng

SNTN Protein Vector (Rat) (pPM-C-HA)

Sign In for Pricing
View Details
9 (S),12 (S),13 (S) -TriHODE
MF-0061093-01 10 mg

9 (S),12 (S),13 (S) -TriHODE

Sign In for Pricing
View Details
9 (S),12 (S),13 (S) -TriHODE
MF-0061093-02 50 mg

9 (S),12 (S),13 (S) -TriHODE

Sign In for Pricing
View Details
Recombinant Saccharomyces cerevisiae Proteasome component PUP2 (PUP2)
MBS1017787-01 0.02 mg (E-Coli)

Recombinant Saccharomyces cerevisiae Proteasome component PUP2 (PUP2)

Sign In for Pricing
View Details