Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

MIRacle™ rno-miR-3574 miRNA Agomir/Antagomir

MicroRNA: rno-miR-3574 Accession Number: MIMAT0017860 Mature Sequence UCAGCCGCUGUCACACGCACAG rno-miR-3574 are small non-coding RNAs of 20-22 nucleotides, typically excised from 60-110 nucleotide foldback RNA precursor structures. miRNAs are involved in crucial biological processes, including development, differentiation, apoptosis, and proliferation, through imperfect pairing with target messenger RNAs (mRNAs) of protein-coding genes and the transcriptional or post-transcriptional regulation of their expression. Click here to browse detailed information about rno-miR-3574 in miRBase. What is MicroRNA Agomir/Antagomir? MicroRNA Agomir is a special-labeled and chemically modified double-stranded small RNA that mimics the endogenous miRNA to regulate the biological function of the target gene. MicroRNA Antagomir is an especially chemically modified miRNA antagonist. It strongly competes with mature miRNAs in the body to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning. Why choose rno-miR-3574 miRNA Agomir/Antagomir from AcceGen? AcceGen has extended experience in MicroRNA Agomir/Antagomir synthesis services that cover all human, mouse, and rat miRNAs in the current miRBase. Compared to standard miRNA mimics and inhibitors, AcceGen miRNA agomir and antagomir are more resistant to degradation, thus having a lasting effect: minimum for 1 week, up to 5-6 weeks. These products can be used in in vitro or in vivo miRNA functional studies.

Product Specifications

Applications

For research use only

Storage Conditions

Room Temperature

More Discoveries

Explore Other Products

Browse additional items from our catalog

SRPK2 Protein Vector (Human) (pPM-C-HA)
PV040147 500 ng

SRPK2 Protein Vector (Human) (pPM-C-HA)

Sign In for Pricing
View Details
Human CDK2 Knockout Cell Line-HCT116
CSC-RT0035 > 10^6 Cells/Vial

Human CDK2 Knockout Cell Line-HCT116

Sign In for Pricing
View Details
Mouse Monoclonal Lamin A + C R453W Antibody (12A-2F5) [CoraFluor 1]
NBP1-77401CL1 0.1 mL

Mouse Monoclonal Lamin A + C R453W Antibody (12A-2F5) [CoraFluor 1]

Sign In for Pricing
View Details
Mouse Monoclonal Alix Antibody (OTI1A4) [DyLight 350]
NBP2-71537UV 0.1 mL

Mouse Monoclonal Alix Antibody (OTI1A4) [DyLight 350]

Sign In for Pricing
View Details
Histone H1.3 (HIST1H1D) (NM_005320) Human Untagged Clone
SC303615 10 µg

Histone H1.3 (HIST1H1D) (NM_005320) Human Untagged Clone

Sign In for Pricing
View Details
Mouse Monoclonal B7-1/CD80 Antibody (2D10.4) [mFluor Violet 610 SE]
NBP1-43384MFV610 0.1 mL

Mouse Monoclonal B7-1/CD80 Antibody (2D10.4) [mFluor Violet 610 SE]

Sign In for Pricing
View Details