Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

MIRacle™ rno-miR-666-3p miRNA Agomir/Antagomir

MicroRNA: rno-miR-666-3p Accession Number: MIMAT0017371 Mature Sequence GGCUGCAGCGUGAUCGCCUGCUC rno-miR-666-3p are small non-coding RNAs of 20-22 nucleotides, typically excised from 60-110 nucleotide foldback RNA precursor structures. miRNAs are involved in crucial biological processes, including development, differentiation, apoptosis, and proliferation, through imperfect pairing with target messenger RNAs (mRNAs) of protein-coding genes and the transcriptional or post-transcriptional regulation of their expression. Click here to browse detailed information about rno-miR-666-3p in miRBase. What is MicroRNA Agomir/Antagomir? MicroRNA Agomir is a special-labeled and chemically modified double-stranded small RNA that mimics the endogenous miRNA to regulate the biological function of the target gene. MicroRNA Antagomir is an especially chemically modified miRNA antagonist. It strongly competes with mature miRNAs in the body to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning. Why choose rno-miR-666-3p miRNA Agomir/Antagomir from AcceGen? AcceGen has extended experience in MicroRNA Agomir/Antagomir synthesis services that cover all human, mouse, and rat miRNAs in the current miRBase. Compared to standard miRNA mimics and inhibitors, AcceGen miRNA agomir and antagomir are more resistant to degradation, thus having a lasting effect: minimum for 1 week, up to 5-6 weeks. These products can be used in in vitro or in vivo miRNA functional studies.

Product Specifications

Applications

For research use only

Storage Conditions

Room Temperature

More Discoveries

Explore Other Products

Browse additional items from our catalog

Matrilin-2 (MATN2, UNQ193/PRO219) (MaxLight 650)
MBS6223125-01 0.1 mL

Matrilin-2 (MATN2, UNQ193/PRO219) (MaxLight 650)

Sign In for Pricing
View Details
Matrilin-2 (MATN2, UNQ193/PRO219) (MaxLight 650)
MBS6223125-02 5x 0.1 mL

Matrilin-2 (MATN2, UNQ193/PRO219) (MaxLight 650)

Sign In for Pricing
View Details
Thyroglobulin Monoclonal Antibody
VAnt-Wyb804 Each

Thyroglobulin Monoclonal Antibody

Sign In for Pricing
View Details
Oxa1l Mouse shRNA Plasmid (Locus ID 69089)
TR515185 1 Kit

Oxa1l Mouse shRNA Plasmid (Locus ID 69089)

Sign In for Pricing
View Details
TOX Protein Vector (Mouse) (pPM-C-HA)
PV240836 500 ng

TOX Protein Vector (Mouse) (pPM-C-HA)

Sign In for Pricing
View Details
CFTR Antibody
V3440-20UG 20 µg

CFTR Antibody

Sign In for Pricing
View Details