Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

MIRacle™ rno-miR-6318 miRNA Agomir/Antagomir

MicroRNA: rno-miR-6318 Accession Number: MIMAT0025055 Mature Sequence CUGCCUGGCGCAGGGCCUGUAG rno-miR-6318 are small non-coding RNAs of 20-22 nucleotides, typically excised from 60-110 nucleotide foldback RNA precursor structures. miRNAs are involved in crucial biological processes, including development, differentiation, apoptosis, and proliferation, through imperfect pairing with target messenger RNAs (mRNAs) of protein-coding genes and the transcriptional or post-transcriptional regulation of their expression. Click here to browse detailed information about rno-miR-6318 in miRBase. What is MicroRNA Agomir/Antagomir? MicroRNA Agomir is a special-labeled and chemically modified double-stranded small RNA that mimics the endogenous miRNA to regulate the biological function of the target gene. MicroRNA Antagomir is an especially chemically modified miRNA antagonist. It strongly competes with mature miRNAs in the body to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning. Why choose rno-miR-6318 miRNA Agomir/Antagomir from AcceGen? AcceGen has extended experience in MicroRNA Agomir/Antagomir synthesis services that cover all human, mouse, and rat miRNAs in the current miRBase. Compared to standard miRNA mimics and inhibitors, AcceGen miRNA agomir and antagomir are more resistant to degradation, thus having a lasting effect: minimum for 1 week, up to 5-6 weeks. These products can be used in in vitro or in vivo miRNA functional studies.

Product Specifications

Applications

For research use only

Storage Conditions

Room Temperature

Frequently Asked Questions

More Discoveries

Explore Other Products

Browse additional items from our catalog

Bcl2-L-13 Recombinant Rabbit monoclonal Antibody
HA751616 100 µL

Bcl2-L-13 Recombinant Rabbit monoclonal Antibody

Sign In for Pricing
View Details
CDC27 (NM_001256) Human Over-expression Lysate
LC400504 20 µg

CDC27 (NM_001256) Human Over-expression Lysate

Sign In for Pricing
View Details
EMA (MUC1) Mouse Monoclonal Antibody (HRP conjugated) [Clone ID: OTI1F3]
TA800769BM 100 µL

EMA (MUC1) Mouse Monoclonal Antibody (HRP conjugated) [Clone ID: OTI1F3]

Sign In for Pricing
View Details
3,4-Dihydroxy-3-cyclobutene-1,2-dione
TRC-D679068-500MG 500 mg

3,4-Dihydroxy-3-cyclobutene-1,2-dione

Sign In for Pricing
View Details
EIF1 (4-8) Rabbit Polyclonal Antibody
AP26070PU-N 100 µL

EIF1 (4-8) Rabbit Polyclonal Antibody

Sign In for Pricing
View Details
COTL1 (NM_021149) Human Over-expression Lysate
LY402845 100 µg

COTL1 (NM_021149) Human Over-expression Lysate

Sign In for Pricing
View Details