Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

MIRacle™ rno-let-7c-5p miRNA Agomir/Antagomir

MicroRNA: rno-let-7c-5p Accession Number: MIMAT0000776 Mature Sequence UGAGGUAGUAGGUUGUAUGGUU rno-let-7c-5p are small non-coding RNAs of 20-22 nucleotides, typically excised from 60-110 nucleotide foldback RNA precursor structures. miRNAs are involved in crucial biological processes, including development, differentiation, apoptosis, and proliferation, through imperfect pairing with target messenger RNAs (mRNAs) of protein-coding genes and the transcriptional or post-transcriptional regulation of their expression. Click here to browse detailed information about rno-let-7c-5p in miRBase. What is MicroRNA Agomir/Antagomir? MicroRNA Agomir is a special-labeled and chemically modified double-stranded small RNA that mimics the endogenous miRNA to regulate the biological function of the target gene. MicroRNA Antagomir is an especially chemically modified miRNA antagonist. It strongly competes with mature miRNAs in the body to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning. Why choose rno-let-7c-5p miRNA Agomir/Antagomir from AcceGen? AcceGen has extended experience in MicroRNA Agomir/Antagomir synthesis services that cover all human, mouse, and rat miRNAs in the current miRBase. Compared to standard miRNA mimics and inhibitors, AcceGen miRNA agomir and antagomir are more resistant to degradation, thus having a lasting effect: minimum for 1 week, up to 5-6 weeks. These products can be used in in vitro or in vivo miRNA functional studies.

Product Specifications

Applications

For research use only

Storage Conditions

Room Temperature

More Discoveries

Explore Other Products

Browse additional items from our catalog

PSMB5 (NM_002797) Human Over-expression Lysate
LH19376V 100 µg

PSMB5 (NM_002797) Human Over-expression Lysate

Sign In for Pricing
View Details
AKR1B1 Knockout SK-HEP-1 Polyclonal Cells
ARG32129 1 Million

AKR1B1 Knockout SK-HEP-1 Polyclonal Cells

Sign In for Pricing
View Details
Il21 (NM_001108943) Rat Tagged Lenti ORF Clone
RR209729L4 10 µg

Il21 (NM_001108943) Rat Tagged Lenti ORF Clone

Sign In for Pricing
View Details
FITC Anti-Mouse CD86 (GL-1)
FITC-30025-01 50 Tests

FITC Anti-Mouse CD86 (GL-1)

Sign In for Pricing
View Details
FITC Anti-Mouse CD86 (GL-1)
FITC-30025-02 100 Tests

FITC Anti-Mouse CD86 (GL-1)

Sign In for Pricing
View Details
Inhibitor mmu-miR-5710 AAV miRNA Vector
Amm3121800 500 ng

Inhibitor mmu-miR-5710 AAV miRNA Vector

Sign In for Pricing
View Details