Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

MIRacle™ rno-let-7c-5p miRNA Agomir/Antagomir

MicroRNA: rno-let-7c-5p Accession Number: MIMAT0000776 Mature Sequence UGAGGUAGUAGGUUGUAUGGUU rno-let-7c-5p are small non-coding RNAs of 20-22 nucleotides, typically excised from 60-110 nucleotide foldback RNA precursor structures. miRNAs are involved in crucial biological processes, including development, differentiation, apoptosis, and proliferation, through imperfect pairing with target messenger RNAs (mRNAs) of protein-coding genes and the transcriptional or post-transcriptional regulation of their expression. Click here to browse detailed information about rno-let-7c-5p in miRBase. What is MicroRNA Agomir/Antagomir? MicroRNA Agomir is a special-labeled and chemically modified double-stranded small RNA that mimics the endogenous miRNA to regulate the biological function of the target gene. MicroRNA Antagomir is an especially chemically modified miRNA antagonist. It strongly competes with mature miRNAs in the body to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning. Why choose rno-let-7c-5p miRNA Agomir/Antagomir from AcceGen? AcceGen has extended experience in MicroRNA Agomir/Antagomir synthesis services that cover all human, mouse, and rat miRNAs in the current miRBase. Compared to standard miRNA mimics and inhibitors, AcceGen miRNA agomir and antagomir are more resistant to degradation, thus having a lasting effect: minimum for 1 week, up to 5-6 weeks. These products can be used in in vitro or in vivo miRNA functional studies.

Product Specifications

Applications

For research use only

Storage Conditions

Room Temperature

More Discoveries

Explore Other Products

Browse additional items from our catalog

Gastrin Releasing Peptide Peptide
DF13618-BP 1 mg

Gastrin Releasing Peptide Peptide

Sign In for Pricing
View Details
Lentiviral mouse Tsc22d2 shRNA (UAS) - Lentiviral mouse Tsc22d2 shRNA (UAS) plasmid
GTR15171619 1 Vial

Lentiviral mouse Tsc22d2 shRNA (UAS) - Lentiviral mouse Tsc22d2 shRNA (UAS) plasmid

Sign In for Pricing
View Details
CD109 antigen (CD109) Human ELISA Kit
C2229 96 Tests

CD109 antigen (CD109) Human ELISA Kit

Sign In for Pricing
View Details
NIPA2P2 Recombinant Protein (Human)
RP078297 100 µg

NIPA2P2 Recombinant Protein (Human)

Sign In for Pricing
View Details
IL17RA Antibody, HRP conjugated
A45135-100UG 100 µg

IL17RA Antibody, HRP conjugated

Sign In for Pricing
View Details
RGD1309534 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-GFP-2A-Puro)
LV681195 1.0 µg DNA

RGD1309534 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-GFP-2A-Puro)

Sign In for Pricing
View Details