Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

MIRacle™ mmu-miR-208a-5p miRNA Agomir/Antagomir

MicroRNA: mmu-miR-208a-5p Accession Number: MIMAT0017014 Mature Sequence: GAGCUUUUGGCCCGGGUUAUAC mmu-miR-208a-5p are small non-coding RNAs of 20-22 nucleotides, typically excised from 60-110 nucleotide foldback RNA precursor structures. miRNAs are involved in crucial biological processes, including development, differentiation, apoptosis, and proliferation, through imperfect pairing with target messenger RNAs (mRNAs) of protein-coding genes and the transcriptional or post-transcriptional regulation of their expression. Click here to browse detailed information about mmu-miR-208a-5p in miRBase. What is MicroRNA Agomir/Antagomir? MicroRNA Agomir is a special-labeled and chemically modified double-stranded small RNA that mimics the endogenous miRNA to regulate the biological function of the target gene. MicroRNA Antagomir is an especially chemically modified miRNA antagonist. It strongly competes with mature miRNAs in the body to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning. Why choose mmu-miR-208a-5p miRNA Agomir/Antagomir from AcceGen? AcceGen has extended experience in MicroRNA Agomir/Antagomir synthesis services that cover all human, mouse, and rat miRNAs in the current miRBase. Compared to standard miRNA mimics and inhibitors, AcceGen miRNA agomir and antagomir are more resistant to degradation, thus having a lasting effect: minimum for 1 week, up to 5-6 weeks. These products can be used in in vitro or in vivo miRNA functional studies.

Product Specifications

Applications

For research use only

Storage Conditions

Room Temperature

More Discoveries

Explore Other Products

Browse additional items from our catalog

COL4A5, NT (COL4A5, Collagen alpha-5(IV) chain) (MaxLight 650)
MBS6287710-01 0.1 mL

COL4A5, NT (COL4A5, Collagen alpha-5(IV) chain) (MaxLight 650)

Sign In for Pricing
View Details
COL4A5, NT (COL4A5, Collagen alpha-5(IV) chain) (MaxLight 650)
MBS6287710-02 5x 0.1 mL

COL4A5, NT (COL4A5, Collagen alpha-5(IV) chain) (MaxLight 650)

Sign In for Pricing
View Details
Recombinant Arabidopsis thaliana RING-H2 finger protein ATL73 (ATL73) , partial
MBS7099685 Inquire

Recombinant Arabidopsis thaliana RING-H2 finger protein ATL73 (ATL73) , partial

Sign In for Pricing
View Details
Mitogen Activated Protein Kinase Kinase Kinase Kinase 5 (MAP4K5)
151954 200 µL

Mitogen Activated Protein Kinase Kinase Kinase Kinase 5 (MAP4K5)

Sign In for Pricing
View Details
Rabbit Polyclonal FNIP1 Antibody [DyLight 594]
NBP3-18249DL594 0.1 mL

Rabbit Polyclonal FNIP1 Antibody [DyLight 594]

Sign In for Pricing
View Details
SLC25A31 (ADP/ATP Translocase 4, ADP, ATP Carrier Protein 4, Adenine Nucleotide Translocator 4, ANT 4, Solute Carrier Family 25 Member 31, Sperm Flagellar Energy Carrier Protein, AAC4, ANT4, SFEC) (PE)
133443-PE 100 µL

SLC25A31 (ADP/ATP Translocase 4, ADP, ATP Carrier Protein 4, Adenine Nucleotide Translocator 4, ANT 4, Solute Carrier Family 25 Member 31, Sperm Flagellar Energy Carrier Protein, AAC4, ANT4, SFEC) (PE)

Sign In for Pricing
View Details