Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

MIRacle™ mmu-miR-3535 miRNA Agomir/Antagomir

MicroRNA: mmu-miR-3535 Accession Number: MIMAT0031410 Mature Sequence: UGGAUAUGAUGACUGAUUACCUGAGA mmu-miR-3535 are small non-coding RNAs of 20-22 nucleotides, typically excised from 60-110 nucleotide foldback RNA precursor structures. miRNAs are involved in crucial biological processes, including development, differentiation, apoptosis, and proliferation, through imperfect pairing with target messenger RNAs (mRNAs) of protein-coding genes and the transcriptional or post-transcriptional regulation of their expression. Click here to browse detailed information about mmu-miR-3535 in miRBase. What is MicroRNA Agomir/Antagomir? MicroRNA Agomir is a special-labeled and chemically modified double-stranded small RNA that mimics the endogenous miRNA to regulate the biological function of the target gene. MicroRNA Antagomir is an especially chemically modified miRNA antagonist. It strongly competes with mature miRNAs in the body to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning. Why choose mmu-miR-3535 miRNA Agomir/Antagomir from AcceGen? AcceGen has extended experience in MicroRNA Agomir/Antagomir synthesis services that cover all human, mouse, and rat miRNAs in the current miRBase. Compared to standard miRNA mimics and inhibitors, AcceGen miRNA agomir and antagomir are more resistant to degradation, thus having a lasting effect: minimum for 1 week, up to 5-6 weeks. These products can be used in in vitro or in vivo miRNA functional studies.

Product Specifications

Applications

For research use only

Storage Conditions

Room Temperature

More Discoveries

Explore Other Products

Browse additional items from our catalog

Col1a2 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 3)
K7064908 1.0 µg DNA

Col1a2 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 3)

Sign In for Pricing
View Details
GTF3A sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 1)
K0917906 1.0 µg DNA

GTF3A sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 1)

Sign In for Pricing
View Details
Dlx5 (NM_010056) Mouse Tagged ORF Clone
MR226751 10 µg

Dlx5 (NM_010056) Mouse Tagged ORF Clone

Sign In for Pricing
View Details
B3GNT4 Peptide
DF15850-BP 1 mg

B3GNT4 Peptide

Sign In for Pricing
View Details
Nafamostat mesylate 25mg
A10617-25 25 mg

Nafamostat mesylate 25mg

Sign In for Pricing
View Details
Myohd1 (BC007156) Mouse Tagged ORF Clone
MR206167 10 µg

Myohd1 (BC007156) Mouse Tagged ORF Clone

Sign In for Pricing
View Details