Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

MIRacle™ mmu-miR-3078-5p miRNA Agomir/Antagomir

MicroRNA: mmu-miR-3078-5p Accession Number: MIMAT0014864 Mature Sequence: CAAAGCCUAGACUGCAGCUACCU mmu-miR-3078-5p are small non-coding RNAs of 20-22 nucleotides, typically excised from 60-110 nucleotide foldback RNA precursor structures. miRNAs are involved in crucial biological processes, including development, differentiation, apoptosis, and proliferation, through imperfect pairing with target messenger RNAs (mRNAs) of protein-coding genes and the transcriptional or post-transcriptional regulation of their expression. Click here to browse detailed information about mmu-miR-3078-5p in miRBase. What is MicroRNA Agomir/Antagomir? MicroRNA Agomir is a special-labeled and chemically modified double-stranded small RNA that mimics the endogenous miRNA to regulate the biological function of the target gene. MicroRNA Antagomir is an especially chemically modified miRNA antagonist. It strongly competes with mature miRNAs in the body to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning. Why choose mmu-miR-3078-5p miRNA Agomir/Antagomir from AcceGen? AcceGen has extended experience in MicroRNA Agomir/Antagomir synthesis services that cover all human, mouse, and rat miRNAs in the current miRBase. Compared to standard miRNA mimics and inhibitors, AcceGen miRNA agomir and antagomir are more resistant to degradation, thus having a lasting effect: minimum for 1 week, up to 5-6 weeks. These products can be used in in vitro or in vivo miRNA functional studies.

Product Specifications

Applications

For research use only

Storage Conditions

Room Temperature

More Discoveries

Explore Other Products

Browse additional items from our catalog

TACO1, NT (TACO1, CCDC44, Translational activator of cytochrome c oxidase 1, Coiled-coil domain-containing protein 44, Translational activator of mitochondrially-encoded cytochrome c oxidase I) (APC) discontinued
042567-APC 200 µL

TACO1, NT (TACO1, CCDC44, Translational activator of cytochrome c oxidase 1, Coiled-coil domain-containing protein 44, Translational activator of mitochondrially-encoded cytochrome c oxidase I) (APC) discontinued

Sign In for Pricing
View Details
Human Cluster of differentiation 36 antibody (CD36 Ab) ELISA Kit
YP-W100352-01 48 Tests

Human Cluster of differentiation 36 antibody (CD36 Ab) ELISA Kit

Sign In for Pricing
View Details
Human Cluster of differentiation 36 antibody (CD36 Ab) ELISA Kit
YP-W100352-02 96 Tests

Human Cluster of differentiation 36 antibody (CD36 Ab) ELISA Kit

Sign In for Pricing
View Details
HBsAb one-step
Z06361 96 Well

HBsAb one-step

Sign In for Pricing
View Details
Aldoa (NM_007438) Mouse Untagged Clone
MC207222 10 µg

Aldoa (NM_007438) Mouse Untagged Clone

Sign In for Pricing
View Details
Mal-L-PA-NH-Boc
MF-0042128-01 10 mg

Mal-L-PA-NH-Boc

Sign In for Pricing
View Details