Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

MIRacle™ mmu-miR-8103 miRNA Agomir/Antagomir

MicroRNA: mmu-miR-8103 Accession Number: MIMAT0031407 Mature Sequence: UCUCCUGUUCUCUGUUCUCCC mmu-miR-8103 are small non-coding RNAs of 20-22 nucleotides, typically excised from 60-110 nucleotide foldback RNA precursor structures. miRNAs are involved in crucial biological processes, including development, differentiation, apoptosis, and proliferation, through imperfect pairing with target messenger RNAs (mRNAs) of protein-coding genes and the transcriptional or post-transcriptional regulation of their expression. Click here to browse detailed information about mmu-miR-8103 in miRBase. What is MicroRNA Agomir/Antagomir? MicroRNA Agomir is a special-labeled and chemically modified double-stranded small RNA that mimics the endogenous miRNA to regulate the biological function of the target gene. MicroRNA Antagomir is an especially chemically modified miRNA antagonist. It strongly competes with mature miRNAs in the body to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning. Why choose mmu-miR-8103 miRNA Agomir/Antagomir from AcceGen? AcceGen has extended experience in MicroRNA Agomir/Antagomir synthesis services that cover all human, mouse, and rat miRNAs in the current miRBase. Compared to standard miRNA mimics and inhibitors, AcceGen miRNA agomir and antagomir are more resistant to degradation, thus having a lasting effect: minimum for 1 week, up to 5-6 weeks. These products can be used in in vitro or in vivo miRNA functional studies.

Product Specifications

Applications

For research use only

Storage Conditions

Room Temperature

Curated Selection

Explore Other Products

Discover premium biology products from our extensive collection of 20M+ items

Lentiviral human SURF4 shRNA (UAS) - Lentiviral human SURF4 shRNA (UAS, iRFP) (25)
GTR15336869 1 Vial

Lentiviral human SURF4 shRNA (UAS) - Lentiviral human SURF4 shRNA (UAS, iRFP) (25)

Ask
View Details
alpha 1 Antitrypsin (SERPINA1) (NM_001127703) Human Tagged ORF Clone Lentiviral Particle
RC225658L3V 200 µL

alpha 1 Antitrypsin (SERPINA1) (NM_001127703) Human Tagged ORF Clone Lentiviral Particle

Ask
View Details
RAC1 (S71) (Ras-related C3 Botulinum Toxin Substrate 1, p21-Rac1, Ras-like Protein TC25, Cell Migration-inducing Gene 5 Protein, TC25, MIG5) (FITC) discontinued
R0400-02E-FITC 200 µL

RAC1 (S71) (Ras-related C3 Botulinum Toxin Substrate 1, p21-Rac1, Ras-like Protein TC25, Cell Migration-inducing Gene 5 Protein, TC25, MIG5) (FITC) discontinued

Ask
View Details
B3GALT6 Human Gene Knockout Kit (CRISPR)
KN223942RB 1 Kit

B3GALT6 Human Gene Knockout Kit (CRISPR)

Ask
View Details
MRPL18 Peptide - N-terminal region
MBS3243535-01 0.1 mg

MRPL18 Peptide - N-terminal region

Ask
View Details
MRPL18 Peptide - N-terminal region
MBS3243535-02 5x 0.1 mg

MRPL18 Peptide - N-terminal region

Ask
View Details