Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

MIRacle™ mmu-miR-8100 miRNA Agomir/Antagomir

MicroRNA: mmu-miR-8100 Accession Number: MIMAT0031403 Mature Sequence: AGGAGGAAAGGGAGCAAGCAGGU mmu-miR-8100 are small non-coding RNAs of 20-22 nucleotides, typically excised from 60-110 nucleotide foldback RNA precursor structures. miRNAs are involved in crucial biological processes, including development, differentiation, apoptosis, and proliferation, through imperfect pairing with target messenger RNAs (mRNAs) of protein-coding genes and the transcriptional or post-transcriptional regulation of their expression. Click here to browse detailed information about mmu-miR-8100 in miRBase. What is MicroRNA Agomir/Antagomir? MicroRNA Agomir is a special-labeled and chemically modified double-stranded small RNA that mimics the endogenous miRNA to regulate the biological function of the target gene. MicroRNA Antagomir is an especially chemically modified miRNA antagonist. It strongly competes with mature miRNAs in the body to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning. Why choose mmu-miR-8100 miRNA Agomir/Antagomir from AcceGen? AcceGen has extended experience in MicroRNA Agomir/Antagomir synthesis services that cover all human, mouse, and rat miRNAs in the current miRBase. Compared to standard miRNA mimics and inhibitors, AcceGen miRNA agomir and antagomir are more resistant to degradation, thus having a lasting effect: minimum for 1 week, up to 5-6 weeks. These products can be used in in vitro or in vivo miRNA functional studies.

Product Specifications

Applications

For research use only

Storage Conditions

Room Temperature

Frequently Asked Questions

More Discoveries

Explore Other Products

Browse additional items from our catalog

Rabbit Monoclonal MICB Antibody (103) [Alexa Fluor 488]
NBP2-89628AF488 0.1 mL

Rabbit Monoclonal MICB Antibody (103) [Alexa Fluor 488]

Sign In for Pricing
View Details
KCNK18 (NM_181840) Human Tagged ORF Clone Lentiviral Particle
RC212920L2V 200 µL

KCNK18 (NM_181840) Human Tagged ORF Clone Lentiviral Particle

Sign In for Pricing
View Details
Ox-LDL Polyclonal Antibody, APC Conjugated
bs-1698R-APC-TR 20 µL

Ox-LDL Polyclonal Antibody, APC Conjugated

Sign In for Pricing
View Details
SUHW1 (H-3) HRP
sc-515056 HRP 200 µg/mL

SUHW1 (H-3) HRP

Sign In for Pricing
View Details
TSC1 Antibody
E51A14525 100 µL

TSC1 Antibody

Sign In for Pricing
View Details
TRIM26 Antibody, HRP conjugated
MBS7110128-01 0.05 mg

TRIM26 Antibody, HRP conjugated

Sign In for Pricing
View Details