Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

MIRacle™ mmu-miR-8099 miRNA Agomir/Antagomir

MicroRNA: mmu-miR-8099 Accession Number: MIMAT0031401 Mature Sequence: CCAAGGCGUGGGAAAGGUUGU mmu-miR-8099 are small non-coding RNAs of 20-22 nucleotides, typically excised from 60-110 nucleotide foldback RNA precursor structures. miRNAs are involved in crucial biological processes, including development, differentiation, apoptosis, and proliferation, through imperfect pairing with target messenger RNAs (mRNAs) of protein-coding genes and the transcriptional or post-transcriptional regulation of their expression. Click here to browse detailed information about mmu-miR-8099 in miRBase. What is MicroRNA Agomir/Antagomir? MicroRNA Agomir is a special-labeled and chemically modified double-stranded small RNA that mimics the endogenous miRNA to regulate the biological function of the target gene. MicroRNA Antagomir is an especially chemically modified miRNA antagonist. It strongly competes with mature miRNAs in the body to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning. Why choose mmu-miR-8099 miRNA Agomir/Antagomir from AcceGen? AcceGen has extended experience in MicroRNA Agomir/Antagomir synthesis services that cover all human, mouse, and rat miRNAs in the current miRBase. Compared to standard miRNA mimics and inhibitors, AcceGen miRNA agomir and antagomir are more resistant to degradation, thus having a lasting effect: minimum for 1 week, up to 5-6 weeks. These products can be used in in vitro or in vivo miRNA functional studies.

Product Specifications

Applications

For research use only

Storage Conditions

Room Temperature

More Discoveries

Explore Other Products

Browse additional items from our catalog

Fam89b 3'UTR Luciferase Stable Cell Line
TU106336 1.0 mL

Fam89b 3'UTR Luciferase Stable Cell Line

Sign In for Pricing
View Details
Anti-CD142/F3/TF Antibody (R1P09)
RHD00603 100 μg

Anti-CD142/F3/TF Antibody (R1P09)

Sign In for Pricing
View Details
SIPA1 AAV Vector (Mouse) (CMV)
43794105 1 µg

SIPA1 AAV Vector (Mouse) (CMV)

Sign In for Pricing
View Details
PGI2 synthase Polyclonal Antibody
UB-GEN-2687 100 µL

PGI2 synthase Polyclonal Antibody

Sign In for Pricing
View Details
HOXA9 protein (His tag)
80R-3800 100 ug

HOXA9 protein (His tag)

Sign In for Pricing
View Details
Acemetacin-d4
TRC-A130702-25MG 25 mg

Acemetacin-d4

Sign In for Pricing
View Details