Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

MIRacle™ mmu-miR-344d-1-5p miRNA Agomir/Antagomir

MicroRNA: mmu-miR-344d-1-5p Accession Number: MIMAT0014819 Mature Sequence: AGUCAGGCUGCUGGCUAUACACCA mmu-miR-344d-1-5p are small non-coding RNAs of 20-22 nucleotides, typically excised from 60-110 nucleotide foldback RNA precursor structures. miRNAs are involved in crucial biological processes, including development, differentiation, apoptosis, and proliferation, through imperfect pairing with target messenger RNAs (mRNAs) of protein-coding genes and the transcriptional or post-transcriptional regulation of their expression. Click here to browse detailed information about mmu-miR-344d-1-5p in miRBase. What is MicroRNA Agomir/Antagomir? MicroRNA Agomir is a special-labeled and chemically modified double-stranded small RNA that mimics the endogenous miRNA to regulate the biological function of the target gene. MicroRNA Antagomir is an especially chemically modified miRNA antagonist. It strongly competes with mature miRNAs in the body to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning. Why choose mmu-miR-344d-1-5p miRNA Agomir/Antagomir from AcceGen? AcceGen has extended experience in MicroRNA Agomir/Antagomir synthesis services that cover all human, mouse, and rat miRNAs in the current miRBase. Compared to standard miRNA mimics and inhibitors, AcceGen miRNA agomir and antagomir are more resistant to degradation, thus having a lasting effect: minimum for 1 week, up to 5-6 weeks. These products can be used in in vitro or in vivo miRNA functional studies.

Product Specifications

Applications

For research use only

Storage Conditions

Room Temperature

More Discoveries

Explore Other Products

Browse additional items from our catalog

Cluster of Differentiation 320 (CD320) Antibody
abx231466 100 µg

Cluster of Differentiation 320 (CD320) Antibody

Sign In for Pricing
View Details
PPAR gamma (PPARG) Human shRNA Plasmid Kit (Locus ID 5468)
TG320459 1 Kit

PPAR gamma (PPARG) Human shRNA Plasmid Kit (Locus ID 5468)

Sign In for Pricing
View Details
Hao2 (NM_032082) Rat Tagged ORF Clone Lentiviral Particle
RR202654L3V 200 µL

Hao2 (NM_032082) Rat Tagged ORF Clone Lentiviral Particle

Sign In for Pricing
View Details
RNU6ATAC4P CRISPRa sgRNA lentivector (set of three targets)(Human)
40515121 3x 1.0µg DNA

RNU6ATAC4P CRISPRa sgRNA lentivector (set of three targets)(Human)

Sign In for Pricing
View Details
LDLRAD2, ID (LDLRAD2, Low-density lipoprotein receptor class A domain-containing protein 2) (MaxLight 490) discontinued
037729-ML490 100 µL

LDLRAD2, ID (LDLRAD2, Low-density lipoprotein receptor class A domain-containing protein 2) (MaxLight 490) discontinued

Sign In for Pricing
View Details
Frozen Tissue Sections, Prostate
CS615497 5x 5 µm

Frozen Tissue Sections, Prostate

Sign In for Pricing
View Details