Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

MIRacle™ mmu-miR-362-3p miRNA Agomir/Antagomir

MicroRNA: mmu-miR-362-3p Accession Number: MIMAT0004684 Mature Sequence: AACACACCUGUUCAAGGAUUCA mmu-miR-362-3p are small non-coding RNAs of 20-22 nucleotides, typically excised from 60-110 nucleotide foldback RNA precursor structures. miRNAs are involved in crucial biological processes, including development, differentiation, apoptosis, and proliferation, through imperfect pairing with target messenger RNAs (mRNAs) of protein-coding genes and the transcriptional or post-transcriptional regulation of their expression. Click here to browse detailed information about mmu-miR-362-3p in miRBase. What is MicroRNA Agomir/Antagomir? MicroRNA Agomir is a special-labeled and chemically modified double-stranded small RNA that mimics the endogenous miRNA to regulate the biological function of the target gene. MicroRNA Antagomir is an especially chemically modified miRNA antagonist. It strongly competes with mature miRNAs in the body to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning. Why choose mmu-miR-362-3p miRNA Agomir/Antagomir from AcceGen? AcceGen has extended experience in MicroRNA Agomir/Antagomir synthesis services that cover all human, mouse, and rat miRNAs in the current miRBase. Compared to standard miRNA mimics and inhibitors, AcceGen miRNA agomir and antagomir are more resistant to degradation, thus having a lasting effect: minimum for 1 week, up to 5-6 weeks. These products can be used in in vitro or in vivo miRNA functional studies.

Product Specifications

Applications

For research use only

Storage Conditions

Room Temperature

More Discoveries

Explore Other Products

Browse additional items from our catalog

Recombinant Mouse Scrapie-responsive protein 1, His-SUMO, E.coli-50ug
QP7487-ec-50ug 50ug

Recombinant Mouse Scrapie-responsive protein 1, His-SUMO, E.coli-50ug

Sign In for Pricing
View Details
Tm2d2 sgRNA CRISPR Lentivector (Rat) (Target 3)
K6531104 1.0 µg DNA

Tm2d2 sgRNA CRISPR Lentivector (Rat) (Target 3)

Sign In for Pricing
View Details
HINFP Recombinant Protein (Mouse)
RP141491 100 µg

HINFP Recombinant Protein (Mouse)

Sign In for Pricing
View Details
DTT, Ultra Pure Grade
40400138-5 100 g

DTT, Ultra Pure Grade

Sign In for Pricing
View Details
Recombinant Saimiriine herpesvirus 2 Envelope glycoprotein B (gB), partial
MBS7060513 Inquire

Recombinant Saimiriine herpesvirus 2 Envelope glycoprotein B (gB), partial

Sign In for Pricing
View Details
KLK6 Polyclonal Antibody
E-AB-64123-01 60 µL

KLK6 Polyclonal Antibody

Sign In for Pricing
View Details