Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

MIRacle™ mmu-miR-7213-5p miRNA Agomir/Antagomir

MicroRNA: mmu-miR-7213-5p Accession Number: MIMAT0028394 Mature Sequence: ACUGGGUCUCUUGAGGUAGC mmu-miR-7213-5p are small non-coding RNAs of 20-22 nucleotides, typically excised from 60-110 nucleotide foldback RNA precursor structures. miRNAs are involved in crucial biological processes, including development, differentiation, apoptosis, and proliferation, through imperfect pairing with target messenger RNAs (mRNAs) of protein-coding genes and the transcriptional or post-transcriptional regulation of their expression. Click here to browse detailed information about mmu-miR-7213-5p in miRBase. What is MicroRNA Agomir/Antagomir? MicroRNA Agomir is a special-labeled and chemically modified double-stranded small RNA that mimics the endogenous miRNA to regulate the biological function of the target gene. MicroRNA Antagomir is an especially chemically modified miRNA antagonist. It strongly competes with mature miRNAs in the body to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning. Why choose mmu-miR-7213-5p miRNA Agomir/Antagomir from AcceGen? AcceGen has extended experience in MicroRNA Agomir/Antagomir synthesis services that cover all human, mouse, and rat miRNAs in the current miRBase. Compared to standard miRNA mimics and inhibitors, AcceGen miRNA agomir and antagomir are more resistant to degradation, thus having a lasting effect: minimum for 1 week, up to 5-6 weeks. These products can be used in in vitro or in vivo miRNA functional studies.

Product Specifications

Applications

For research use only

Storage Conditions

Room Temperature

More Discoveries

Explore Other Products

Browse additional items from our catalog

KAT5 (NM_182710) Human Over-expression Lysate
LC405423 20 µg

KAT5 (NM_182710) Human Over-expression Lysate

Sign In for Pricing
View Details
HIST2H2AA3 Rabbit Polyclonal Antibody (N-term)
E28PB1220 100 µL

HIST2H2AA3 Rabbit Polyclonal Antibody (N-term)

Sign In for Pricing
View Details
Rat Granzyme B CLIA Kit
MBS8426764-01 1 Kit

Rat Granzyme B CLIA Kit

Sign In for Pricing
View Details
Rat Granzyme B CLIA Kit
MBS8426764-02 5x 1 Kit

Rat Granzyme B CLIA Kit

Sign In for Pricing
View Details
WNT3A (Wingless-type MMTV Integration Site Family Member 3A, Protein Wnt-3a) (MaxLight 650)
135397-ML650 100 µL

WNT3A (Wingless-type MMTV Integration Site Family Member 3A, Protein Wnt-3a) (MaxLight 650)

Sign In for Pricing
View Details
ARHGF discontinued
533235-01 30ul

ARHGF discontinued

Sign In for Pricing
View Details