Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

MIRacle™ mmu-miR-30c-1-3p miRNA Agomir/Antagomir

MicroRNA: mmu-miR-30c-1-3p Accession Number: MIMAT0004616 Mature Sequence: CUGGGAGAGGGUUGUUUACUCC mmu-miR-30c-1-3p are small non-coding RNAs of 20-22 nucleotides, typically excised from 60-110 nucleotide foldback RNA precursor structures. miRNAs are involved in crucial biological processes, including development, differentiation, apoptosis, and proliferation, through imperfect pairing with target messenger RNAs (mRNAs) of protein-coding genes and the transcriptional or post-transcriptional regulation of their expression. Click here to browse detailed information about mmu-miR-30c-1-3p in miRBase. What is MicroRNA Agomir/Antagomir? MicroRNA Agomir is a special-labeled and chemically modified double-stranded small RNA that mimics the endogenous miRNA to regulate the biological function of the target gene. MicroRNA Antagomir is an especially chemically modified miRNA antagonist. It strongly competes with mature miRNAs in the body to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning. Why choose mmu-miR-30c-1-3p miRNA Agomir/Antagomir from AcceGen? AcceGen has extended experience in MicroRNA Agomir/Antagomir synthesis services that cover all human, mouse, and rat miRNAs in the current miRBase. Compared to standard miRNA mimics and inhibitors, AcceGen miRNA agomir and antagomir are more resistant to degradation, thus having a lasting effect: minimum for 1 week, up to 5-6 weeks. These products can be used in in vitro or in vivo miRNA functional studies.

Product Specifications

Applications

For research use only

Storage Conditions

Room Temperature

More Discoveries

Explore Other Products

Browse additional items from our catalog

Rabbit Polyclonal SPNS1 Antibody
NBP1-92440-25ul 25 µL

Rabbit Polyclonal SPNS1 Antibody

Sign In for Pricing
View Details
4833427G06Rik Protein Vector (Mouse) (pPM-C-HA)
PV148844 500 ng

4833427G06Rik Protein Vector (Mouse) (pPM-C-HA)

Sign In for Pricing
View Details
Ccdc110 Mouse shRNA Lentiviral Particle (Locus ID 212392)
TL509824V 500 µL Each

Ccdc110 Mouse shRNA Lentiviral Particle (Locus ID 212392)

Sign In for Pricing
View Details
PRKAG1 Recombinant Protein (Rat)
RP222038 100 µg

PRKAG1 Recombinant Protein (Rat)

Sign In for Pricing
View Details
Human LMO3 knockout cell line
ABC-KH8524 1 Vial

Human LMO3 knockout cell line

Sign In for Pricing
View Details
RANBP9 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 1)
K1784006 1.0 µg DNA

RANBP9 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 1)

Sign In for Pricing
View Details