Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

MIRacle™ mmu-miR-8095 miRNA Agomir/Antagomir

MicroRNA: mmu-miR-8095 Accession Number: MIMAT0031396 Mature Sequence: AAAGGAUUCUGCUGUCUGUCCC mmu-miR-8095 are small non-coding RNAs of 20-22 nucleotides, typically excised from 60-110 nucleotide foldback RNA precursor structures. miRNAs are involved in crucial biological processes, including development, differentiation, apoptosis, and proliferation, through imperfect pairing with target messenger RNAs (mRNAs) of protein-coding genes and the transcriptional or post-transcriptional regulation of their expression. Click here to browse detailed information about mmu-miR-8095 in miRBase. What is MicroRNA Agomir/Antagomir? MicroRNA Agomir is a special-labeled and chemically modified double-stranded small RNA that mimics the endogenous miRNA to regulate the biological function of the target gene. MicroRNA Antagomir is an especially chemically modified miRNA antagonist. It strongly competes with mature miRNAs in the body to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning. Why choose mmu-miR-8095 miRNA Agomir/Antagomir from AcceGen? AcceGen has extended experience in MicroRNA Agomir/Antagomir synthesis services that cover all human, mouse, and rat miRNAs in the current miRBase. Compared to standard miRNA mimics and inhibitors, AcceGen miRNA agomir and antagomir are more resistant to degradation, thus having a lasting effect: minimum for 1 week, up to 5-6 weeks. These products can be used in in vitro or in vivo miRNA functional studies.

Product Specifications

Applications

For research use only

Storage Conditions

Room Temperature

More Discoveries

Explore Other Products

Browse additional items from our catalog

PPT1, ID (PPT1, PPT, Palmitoyl-protein thioesterase 1, Palmitoyl-protein hydrolase 1) (Azide free) (HRP)
MBS6336779-01 0.2 mL

PPT1, ID (PPT1, PPT, Palmitoyl-protein thioesterase 1, Palmitoyl-protein hydrolase 1) (Azide free) (HRP)

Sign In for Pricing
View Details
PPT1, ID (PPT1, PPT, Palmitoyl-protein thioesterase 1, Palmitoyl-protein hydrolase 1) (Azide free) (HRP)
MBS6336779-02 5x 0.2 mL

PPT1, ID (PPT1, PPT, Palmitoyl-protein thioesterase 1, Palmitoyl-protein hydrolase 1) (Azide free) (HRP)

Sign In for Pricing
View Details
Cortisol Binding Globulin, ID (CBG, Corticosteroid Binding Globulin, SERPINA6, Serine or Cysteine Proteinase Inhibitor Clade A, alpha-1 Antiproteinase, alpha-1 Antiproteinase, Transcortin) (Biotin) discontinued
041576-Biotin 200 µL

Cortisol Binding Globulin, ID (CBG, Corticosteroid Binding Globulin, SERPINA6, Serine or Cysteine Proteinase Inhibitor Clade A, alpha-1 Antiproteinase, alpha-1 Antiproteinase, Transcortin) (Biotin) discontinued

Sign In for Pricing
View Details
Mouse Ras GTPase-activating-like protein IQGAP1 (IQGAP1) ELISA Kit
RK13216 96 Tests

Mouse Ras GTPase-activating-like protein IQGAP1 (IQGAP1) ELISA Kit

Sign In for Pricing
View Details
UGGT2 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)
49102111 3x 1.0 µg

UGGT2 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)

Sign In for Pricing
View Details
Ectonucleotide Pyrophosphatase/Phosphodiesterase 2 (ENPP2) BioAssayTM ELISA Kit (Human)
024755 96 Tests

Ectonucleotide Pyrophosphatase/Phosphodiesterase 2 (ENPP2) BioAssayTM ELISA Kit (Human)

Sign In for Pricing
View Details