Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

MIRacle™ mmu-miR-8093 miRNA Agomir/Antagomir

MicroRNA: mmu-miR-8093 Accession Number: MIMAT0031394 Mature Sequence: UUGGGGAGCAGAGCAUGAGUG mmu-miR-8093 are small non-coding RNAs of 20-22 nucleotides, typically excised from 60-110 nucleotide foldback RNA precursor structures. miRNAs are involved in crucial biological processes, including development, differentiation, apoptosis, and proliferation, through imperfect pairing with target messenger RNAs (mRNAs) of protein-coding genes and the transcriptional or post-transcriptional regulation of their expression. Click here to browse detailed information about mmu-miR-8093 in miRBase. What is MicroRNA Agomir/Antagomir? MicroRNA Agomir is a special-labeled and chemically modified double-stranded small RNA that mimics the endogenous miRNA to regulate the biological function of the target gene. MicroRNA Antagomir is an especially chemically modified miRNA antagonist. It strongly competes with mature miRNAs in the body to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning. Why choose mmu-miR-8093 miRNA Agomir/Antagomir from AcceGen? AcceGen has extended experience in MicroRNA Agomir/Antagomir synthesis services that cover all human, mouse, and rat miRNAs in the current miRBase. Compared to standard miRNA mimics and inhibitors, AcceGen miRNA agomir and antagomir are more resistant to degradation, thus having a lasting effect: minimum for 1 week, up to 5-6 weeks. These products can be used in in vitro or in vivo miRNA functional studies.

Product Specifications

Applications

For research use only

Storage Conditions

Room Temperature

Frequently Asked Questions

More Discoveries

Explore Other Products

Browse additional items from our catalog

pExpress-1-Zbed3 Plasmid
PVT40285 2 µg

pExpress-1-Zbed3 Plasmid

Sign In for Pricing
View Details
Cyclin B3 (CCNB3) (NM_033031) Human Tagged ORF Clone
RG217591 10 µg

Cyclin B3 (CCNB3) (NM_033031) Human Tagged ORF Clone

Sign In for Pricing
View Details
E.coli FocA Rabbit Polyclonal Antibody (Cy3)
orb2571405 200 µL

E.coli FocA Rabbit Polyclonal Antibody (Cy3)

Sign In for Pricing
View Details
Recombinant Xenopus laevis Transmembrane protein 82 (tmem82), partial
MBS7057884 Inquire

Recombinant Xenopus laevis Transmembrane protein 82 (tmem82), partial

Sign In for Pricing
View Details
Gltp Rat siRNA Oligo Duplex (Locus ID 288707)
SR508936 1 Kit

Gltp Rat siRNA Oligo Duplex (Locus ID 288707)

Sign In for Pricing
View Details
STFR P022-150x50-PP-CRD/1 Facility & Office Signs (No Adhesive)
824700 1 Card (1 Panel (s) x 1 Pack)

STFR P022-150x50-PP-CRD/1 Facility & Office Signs (No Adhesive)

Sign In for Pricing
View Details