Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

MIRacle™ mmu-miR-5618-5p miRNA Agomir/Antagomir

MicroRNA: mmu-miR-5618-5p Accession Number: MIMAT0022363 Mature Sequence: UACCCUUUACACCGUGUAGU mmu-miR-5618-5p are small non-coding RNAs of 20-22 nucleotides, typically excised from 60-110 nucleotide foldback RNA precursor structures. miRNAs are involved in crucial biological processes, including development, differentiation, apoptosis, and proliferation, through imperfect pairing with target messenger RNAs (mRNAs) of protein-coding genes and the transcriptional or post-transcriptional regulation of their expression. Click here to browse detailed information about mmu-miR-5618-5p in miRBase. What is MicroRNA Agomir/Antagomir? MicroRNA Agomir is a special-labeled and chemically modified double-stranded small RNA that mimics the endogenous miRNA to regulate the biological function of the target gene. MicroRNA Antagomir is an especially chemically modified miRNA antagonist. It strongly competes with mature miRNAs in the body to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning. Why choose mmu-miR-5618-5p miRNA Agomir/Antagomir from AcceGen? AcceGen has extended experience in MicroRNA Agomir/Antagomir synthesis services that cover all human, mouse, and rat miRNAs in the current miRBase. Compared to standard miRNA mimics and inhibitors, AcceGen miRNA agomir and antagomir are more resistant to degradation, thus having a lasting effect: minimum for 1 week, up to 5-6 weeks. These products can be used in in vitro or in vivo miRNA functional studies.

Product Specifications

Applications

For research use only

Storage Conditions

Room Temperature

More Discoveries

Explore Other Products

Browse additional items from our catalog

Rabbit Polyclonal RAR beta/NR1B2 Antibody [DyLight 650]
NBP2-98903C 0.1 mL

Rabbit Polyclonal RAR beta/NR1B2 Antibody [DyLight 650]

Sign In for Pricing
View Details
Rabbit anti-Arabidopsis thaliana (Mouse-ear cress) HS1 Polyclonal Antibody
MBS9008476 Inquire

Rabbit anti-Arabidopsis thaliana (Mouse-ear cress) HS1 Polyclonal Antibody

Sign In for Pricing
View Details
Mouse NFKBID siRNA
abx925833-01 15 nmol

Mouse NFKBID siRNA

Sign In for Pricing
View Details
Mouse NFKBID siRNA
abx925833-02 30 nmol

Mouse NFKBID siRNA

Sign In for Pricing
View Details
SLC11A1 (Natural Resistance-associated Macrophage Protein 1, NRAMP 1, LSH, NRAMP, NRAMP1)
133396 100 µg

SLC11A1 (Natural Resistance-associated Macrophage Protein 1, NRAMP 1, LSH, NRAMP, NRAMP1)

Sign In for Pricing
View Details
Recombinant Human NCR3/NKp30/CD337 Protein (C-6His)
E53A06202 50 µg

Recombinant Human NCR3/NKp30/CD337 Protein (C-6His)

Sign In for Pricing
View Details