Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

MIRacle™ mmu-miR-7007-5p miRNA Agomir/Antagomir

MicroRNA: mmu-miR-7007-5p Accession Number: MIMAT0027918 Mature Sequence: UCAGAAGAGGCAGUGGAGGAGAU mmu-miR-7007-5p are small non-coding RNAs of 20-22 nucleotides, typically excised from 60-110 nucleotide foldback RNA precursor structures. miRNAs are involved in crucial biological processes, including development, differentiation, apoptosis, and proliferation, through imperfect pairing with target messenger RNAs (mRNAs) of protein-coding genes and the transcriptional or post-transcriptional regulation of their expression. Click here to browse detailed information about mmu-miR-7007-5p in miRBase. What is MicroRNA Agomir/Antagomir? MicroRNA Agomir is a special-labeled and chemically modified double-stranded small RNA that mimics the endogenous miRNA to regulate the biological function of the target gene. MicroRNA Antagomir is an especially chemically modified miRNA antagonist. It strongly competes with mature miRNAs in the body to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning. Why choose mmu-miR-7007-5p miRNA Agomir/Antagomir from AcceGen? AcceGen has extended experience in MicroRNA Agomir/Antagomir synthesis services that cover all human, mouse, and rat miRNAs in the current miRBase. Compared to standard miRNA mimics and inhibitors, AcceGen miRNA agomir and antagomir are more resistant to degradation, thus having a lasting effect: minimum for 1 week, up to 5-6 weeks. These products can be used in in vitro or in vivo miRNA functional studies.

Product Specifications

Applications

For research use only

Storage Conditions

Room Temperature

More Discoveries

Explore Other Products

Browse additional items from our catalog

Rabbit anti-Caenorhabditis elegans ndx-1 Polyclonal Antibody
MBS7183526 Inquire

Rabbit anti-Caenorhabditis elegans ndx-1 Polyclonal Antibody

Sign In for Pricing
View Details
Z-Thr(tBu)-OH·DCHA
5-07510 100 g

Z-Thr(tBu)-OH·DCHA

Sign In for Pricing
View Details
Mouse Monoclonal B7-H4 Antibody (973816) [HRP]
FAB65761H 0.1 mL

Mouse Monoclonal B7-H4 Antibody (973816) [HRP]

Sign In for Pricing
View Details
EML1 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)
K0678405 3x 1.0 µg

EML1 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)

Sign In for Pricing
View Details
CACNA1C-IT1 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV)
LV720395 1.0 µg DNA

CACNA1C-IT1 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV)

Sign In for Pricing
View Details
Creatine Kinase MB Isoenzyme (Creatine Kinase MB Type, CKMB) (Biotin)
MBS6127359-01 0.1 mL

Creatine Kinase MB Isoenzyme (Creatine Kinase MB Type, CKMB) (Biotin)

Sign In for Pricing
View Details