Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

MIRacle™ mmu-miR-6909-3p miRNA Agomir/Antagomir

MicroRNA: mmu-miR-6909-3p Accession Number: MIMAT0027719 Mature Sequence: UGCCUUCCCCGGCCUCCCACAG mmu-miR-6909-3p are small non-coding RNAs of 20-22 nucleotides, typically excised from 60-110 nucleotide foldback RNA precursor structures. miRNAs are involved in crucial biological processes, including development, differentiation, apoptosis, and proliferation, through imperfect pairing with target messenger RNAs (mRNAs) of protein-coding genes and the transcriptional or post-transcriptional regulation of their expression. Click here to browse detailed information about mmu-miR-6909-3p in miRBase. What is MicroRNA Agomir/Antagomir? MicroRNA Agomir is a special-labeled and chemically modified double-stranded small RNA that mimics the endogenous miRNA to regulate the biological function of the target gene. MicroRNA Antagomir is an especially chemically modified miRNA antagonist. It strongly competes with mature miRNAs in the body to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning. Why choose mmu-miR-6909-3p miRNA Agomir/Antagomir from AcceGen? AcceGen has extended experience in MicroRNA Agomir/Antagomir synthesis services that cover all human, mouse, and rat miRNAs in the current miRBase. Compared to standard miRNA mimics and inhibitors, AcceGen miRNA agomir and antagomir are more resistant to degradation, thus having a lasting effect: minimum for 1 week, up to 5-6 weeks. These products can be used in in vitro or in vivo miRNA functional studies.

Product Specifications

Applications

For research use only

Storage Conditions

Room Temperature

More Discoveries

Explore Other Products

Browse additional items from our catalog

EMAP2 Polyclonal Antibody, AbBy Fluor™ 750 Conjugated
bs-5908R-BF750 100 µL

EMAP2 Polyclonal Antibody, AbBy Fluor™ 750 Conjugated

Sign In for Pricing
View Details
UCP2, NT (Mitochondrial Uncoupling Protein 2, UCP 2, Solute Carrier Family 25 Member 8, UCPH, SLC25A8) discontinued
U1621-13A 50 µL

UCP2, NT (Mitochondrial Uncoupling Protein 2, UCP 2, Solute Carrier Family 25 Member 8, UCPH, SLC25A8) discontinued

Sign In for Pricing
View Details
Human ZEB1 Alexa Fluor 700 Antibody (Clone 639914)
FAB6708N-100UG 100 µg

Human ZEB1 Alexa Fluor 700 Antibody (Clone 639914)

Sign In for Pricing
View Details
Prl2c1 Protein Vector (Mouse) (pPB-N-His)
PV219375 500 ng

Prl2c1 Protein Vector (Mouse) (pPB-N-His)

Sign In for Pricing
View Details
Frozen Tissue Sections, Colon
CS638426 5x 5 µm

Frozen Tissue Sections, Colon

Sign In for Pricing
View Details
Recombinant Mycobacterium Vanbaalenii hisB Protein (aa 1-208)
VAng-Yyj5212-500gEcoli 500 µg (E. coli)

Recombinant Mycobacterium Vanbaalenii hisB Protein (aa 1-208)

Sign In for Pricing
View Details